हिंदी

HSC Science (General) १२ वीं कक्षा - Maharashtra State Board Important Questions

Advertisements
विषयों
अध्याय
विषयों
मुख्य विषय
अध्याय

Please select a subject first

Advertisements
Advertisements
< prev  1161 to 1180 of 5132  next > 

Short Answer Question:

Write a note on Human genome project (HGP).

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Human Genome Project

Find the odd one out:

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Packaging of DNA Helix

What happened when heat-killed S-cells along with living R-cells were injected into mice?

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Deoxyribonucleic Acid (DNA)

Semiconservative mechanism of DNA was detected using:

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

What is the role of Mg++ in Translation?

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Protein Synthesis

Enlist the names of enzymes used in semiconservative replication of DNA?

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Differentiate between Heterochromatin & Euchromatin.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Packaging of DNA Helix

Draw a neat and labelled diagram of the Nucleosome.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Packaging of DNA Helix

Draw neat and labelled diagram of Replication Fork.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Draw a neat and labelled diagram of transcription and processing of hn-RNA

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Protein Synthesis

How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Histones are rich in ______.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Packaging of DNA Helix

During the replication of DNA, the separated strands are prevented from recoiling by using ______.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Write the aims of the human genome project.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Human Genome Project

The nucleic acid synthesis takes place in ______.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Describe the process of transcription.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Protein Synthesis

Distinguish between heterochromatin and euchromatin with reference to staining property and activity.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Packaging of DNA Helix

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Give the different steps involved in formation of m-RNA from hn-RNA.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Protein Synthesis
< prev  1161 to 1180 of 5132  next > 
Advertisements
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×