English

Biology Delhi Set 2 2022-2023 Science (English Medium) Class 12 Question Paper Solution

Advertisements
Biology [Delhi Set 2]
Marks: 70 CBSE
Science (English Medium)

Academic Year: 2022-2023
Date & Time: 16th March 2023, 10:30 am
Duration: 3h
Advertisements

General Instructions:

Read the following instructions very carefully and strictly follow them:

  1. This question paper contains 33 questions. All questions are compulsory.
  2. Question paper is divided into FIVE sections - Section A, B, C, D and E.
  3. Section A - question number 1 to 16 are Multiple Choice (MCQ) type questions carrying 1 mark each.
  4. Section B - question number 17 to 21 are Very Short Answer (VSA) type questions carrying 2 marks each.
  5. Section C - question number 22 to 28 are Short Answer (SA) type questions carrying 3 marks each.
  6. Section D - question number 29 and 30 are case-based questions carrying 4 marks each. Each question has subparts with internal choice in one subpart.
  7. Section E - question number 31 to 33 are Long Answer (LA) type questions carrying 5 marks each.
  8. There is no overall choice. However, an internal choice has been provided in 1 question in Section B, 1 question in Section C, 2 questions in Section D and 1 question in Section E. A candidate has to attempt only one of the alternatives in such questions.
  9. Wherever necessary, neat and properly labelled diagrams should be drawn.

SECTION - A
[1]1

Interferons are proteins. In humans they are secreted by ______.

Thymus gland

B-lymphocytes

Viral infected cells

Tonsils

Concept: undefined - undefined
Chapter:
[1]2

Given below are Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART:

Column A Column B
S. No. Names of ART S. No. Procedures
(A) GIFT (i) Transfer of ovum from a donor into the fallopian tube of another female.
(B) ICSI (ii) Transfer of semen from the donor into the vagina of the female.
(C) ZIFT (iii) Injecting sperm directly into the ovum.
(D) IUI (iv) Transfer of early embryos into the fallopian tube.

Choose the option where ART correctly matches with the procedure.

(A)-(i), B-(ii), (C)-(iii), (D)-(iv)

(A)-(iv), B-(i), (C)-(ii), (D)-(iii)

(A)-(iv), B-(iii), (C)-(i), (D)-(ii)

(A)-(i), B-(iii), (C)-(iv), (D)-(ii)

Concept: undefined - undefined
Chapter: [3] Reproductive Health
[1]3

The decrease in the T-lymphocyte count in human blood will result in ______.

Decrease in antigens 

Decrease in antibodies

Increase in antibodies

Increase in antigens

Concept: undefined - undefined
Chapter:
[1]4

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Phenylalanine, Methionine

Cysteine, Glycine

Alanine, Proline

Serine, Valine

Concept: undefined - undefined
Chapter: [5] Molecular Basis of Inheritance
[1]5

Given below are four aspects of Reproductive Health in Column A and their related information in Column B:

  Column A   Column B
S. No. Terms used in Reproductive Health S. No. Significant information
(A) MTP (i) Analysing fetal cells from amniotic fluid of the foetus
(B) Amniocentesis (ii) Legalised in 1971
(C) Saheli (iii) Programme initiated in 1951
(D) Family Planning (iv) Non-steroidal oral Planning contraceptive

Select the correct match from the following options:

(A)-(iv), B-(ii), (C)-(iii), (D)-(i)

(A)-(ii), B-(i), (C)-(iv), (D)-(iii)

(A)-(i), B-(iii), (C)-(ii), (D)-(iv)

(A) (ii), B-(i), (C)-(iii), (D)-(iv)

Concept: undefined - undefined
Chapter: [3] Reproductive Health
[1]6

Select the pathogen mismatched with the symptoms of disease caused by it from the list given below:

Entamoeba histolytica: Constipation, abdominal pain

Epidermophyton: Dry scaly lesions on nail

Wuchereria bancrofti: Chronic inflammation of lymphatic vessels of lower limb

Haemophilus influenzae: Blockage of the intestinal passage

Concept: undefined - undefined
Chapter:
[1]7

The primary productivity in an ecosystem is expressed as ______.

  1. gm-2 yr-1
  2. gm-2 yr
  3. Kcal m-2 yr-1
  4. Kcal m-2
Concept: undefined - undefined
Chapter: [12] Ecosystem
[1]8

Interaction between clown fish living among the stinging tentacles of sea anemone is an example of ______.

Amensalism

Parasitism

Mutualism

Commensalism

Concept: undefined - undefined
Chapter: [11] Organisms and Populations
[1]9

The IUCN Red Data List (2004) in the last 500 years documents the extinction of nearly 784 species including ______.

330 invertebrates

338 invertebrates

359 invertebrates

362 invertebrates

Concept: undefined - undefined
Chapter: [13] Biodiversity and Its Conservation
[1]10

Which one of the following groups faces maximum threat of extinction? 

Gymnosperm

Birds

Amphibian

Mammals

Concept: undefined - undefined
Chapter: [13] Biodiversity and Its Conservation
[1]11

Important attributes belonging to a population but not to an individual are:

  1. Birth rate and death rate
  2. Male and female
  3. Birth and death
  4. Sex-ratio

Select the correct option from the given options:

(i) only

(ii) only

(ii) and (iii)

(i) and (iv)

Concept: undefined - undefined
Chapter: [11] Organisms and Populations
[1]12

Select the option that shows the correctly identified 'U', 'X', 'Y' and 'Z' in a developing dicot embryo.

X - Plumule (2n), Y - Suspensor (n), Z - Cotyledon (2n), U - Radicle (2n).

X - Plumule (2n), Y - Suspensor (2n), Z- Radicle (2n), U - Cotyledon (2n).

X - Suspensor (2n), Y - Cotyledon (2n), Z - Radicle (2n), U - Plumule (2n).

X - Cotyledon (2n), Y - Radicle (n), Z - Plumule (n), U - Suspensor (n).

Concept: undefined - undefined
Chapter:
[1]13 | Question Nos. 13 to 16 consists of two statements, Assertion (A) and Reason (R). Answer these questions selecting the appropriate option given below:

Assertion (A): Determining the sex of an unborn child followed by MTP is an illegal practice.

Reason (R): Amniocentesis is a practice to test the presence of genetic disorders also.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Concept: undefined - undefined
Chapter: [3] Reproductive Health
[1]14

Assertion (A): Synthetic oligonucleotide polymers are used during Annealing in a PCR.

Reason (R): The primers bind to the double stranded DNA at their complementary regions.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Concept: undefined - undefined
Chapter: [9] Biotechnology - Principles and Processes
[1]15

Assertion (A): Decomposition process is slower if detritus is rich in lignin and cutin.

Reason (R): Decomposition is largely an oxygen requiring process.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Concept: undefined - undefined
Chapter: [12] Ecosystem
[1]16

Assertion (A): In Thalassemia an abnormal myoglobin chain is synthesized due to a gene defect.

Reason (R): α-Thalassemia is controlled by genes HBA-1 and HBA-2 on chromosome 16.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Concept: undefined - undefined
Chapter:
SECTION - B
[2]17
[2]17.a

State the principle involved in separation of DNA fragments using gel electrophoresis.

Concept: undefined - undefined
Chapter: [9] Biotechnology - Principles and Processes
OR
[2]17.b

How are DNA fragments visualised once they are separated by gel electrophoresis?

Concept: undefined - undefined
Chapter: [9] Biotechnology - Principles and Processes
[2]18
Advertisements
[2]18.a
  1. Give an example of a genus of fungi that forms mycorhizal association with plants. 
  2. How does the plant derive benefits from this association?
Concept: undefined - undefined
Chapter: [8] Microbes in Human Welfare
OR
[2]18.b

Name any two techniques used to detect the cancer of internal organs and write about any one of them.

Concept: undefined - undefined
Chapter: [7] Human Health and Diseases
[2]19

By using Punnett square depict the genotypes and phenotypes of test crosses (where green pod colour (G) is dominant over yellow pod colour (g)) in Garden pea with unknown genotype.

Concept: undefined - undefined
Chapter: [4] Principles of Inheritance and Variation
[2]20

"Abingdon tortoise in Galapagos islands became extinct within a decade on introduction of goats in the island." Explain giving reason.

Concept: undefined - undefined
Chapter: [11] Organisms and Populations
[2]21
[1]21.a

Write the scientific name of the source organism of the thermostable DNA polymerase used in PCR.

Concept: undefined - undefined
Chapter: [9] Biotechnology - Principles and Processes
[1]21.b

State the advantage of using Thermostable DNA polymerase.

Concept: undefined - undefined
Chapter: [9] Biotechnology - Principles and Processes
SECTION - C
[3]22

Explain how did the experiment conducted by S.L. Miller substantiate that life evolved from preexisting nonliving organic molecules.

Concept: undefined - undefined
Chapter:
[3]23
[2]23.a

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Enlist any four prime goals of HGP.

Concept: undefined - undefined
Chapter: [5] Molecular Basis of Inheritance
[1]23.b

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Name any one common non-human animal model organism which has also been sequenced thereafter.

Concept: undefined - undefined
Chapter: [5] Molecular Basis of Inheritance
[3]24

Industrial melanism in England after 1850 is an excellent example of Natural selection. Explain how?

Concept: undefined - undefined
Chapter:
[3]25

One of the major approaches of crop improvement programme is Artificial Hybridisation. Explain the steps involved in making sure that only the desired pollen grain pollinate the stigma of a bisexual flower by a plant breeder. 

Concept: undefined - undefined
Chapter: [1] Sexual Reproduction in Flowering Plants
[3]26
[3]26.a

“Plasmodium protozoan needs both a mosquito and a human host for its continuity.” Explain.

Concept: undefined - undefined
Chapter:
OR
[3]26.b

We all must work towards maintaining good health because ‘health is wealth'. Enlist any six ways of achieving good health.

Concept: undefined - undefined
Chapter:
[3]27

Eli Lilly's contribution for diabetic patients through r-DNA technology has been overwhelmingly accepted. Explain how?

Concept: undefined - undefined
Chapter: [8] Microbes in Human Welfare
[3]28
[1.5]28.a

"Biodiversity plays a major role in many ecosystem services that nature provides."

Describe any two broadly utilitarian arguments to justify the given statement.

Concept: undefined - undefined
Chapter: [13] Biodiversity and Its Conservation
[1.5]28.b

"Biodiversity plays a major role in many ecosystem services that nature provides."

State one ethical reason for conserving biodiversity.

Concept: undefined - undefined
Chapter: [13] Biodiversity and Its Conservation
Advertisements
SECTION - D
[4]29 | Q.no 29 and 30 are case based questions. Each question has subparts with internal choice in one subpart.
When a microorganism invades a host, a definite sequence of events usually occurs leading to infection and disease, causing suffering to the host. This process is called pathogenesis. Once a microorganism overcomes the defence system of the host, development of the disease follows a certain sequence of events as shown in the graph. Study the graph given below for the sequence of events leading to the appearance of a disease and answer the questions that follow:

(a) In which period, according to the graph there are maximum chances of a person transmitting a disease/infection and why? (1)

(b) Study the graph and write what is an incubation period. Name a sexually transmitted disease that can be easily transmitted during this period. Name the specific type of lymphocytes that are attacked by the pathogen of this disease. (2)

OR

(b) Draw a schematic labelled diagram of an antibody. (2)

(c) In which period, the number of immune cells forming antibodies will be the highest in a person suffering from pneumonia? Name the immune cells that produce antibodies. (1)

Concept: undefined - undefined
Chapter:
[4]30

The chromosome number is fixed for all normal organisms leading to species specification whereas any abnormality in the chromosome number of an organism results into abnormal individuals. For example, in humans, 46 is the fixed number of chromosomes both male and female. In males it is '44 + XY' and in females, it is '44 +XX'. Thus the human male is heterogametic, in other words produces two different types of gametes one with '22 + X' chromosomes and the other with '22 + Y' chromosomes respectively. Human female, on the other hand, is homo gametic i.e. produce only one type of gamete with '22 + X' chromosomes only.

Sometimes an error may occur during the meiosis of the cell cycle, where the sister chromatids fail to segregate called nondisjunction, leading to the production of abnormal gametes with altered chromosome numbers. On fertilisation, such gametes develop into abnormal individuals.

(a) State what is aneuploidy. (1)

(b) If during spermatogenesis, the chromatids of sex chromosomes fail to segregate during meiosis, write only the different types of gametes with altered chromosome numbers that could possibly be produced. (1)

(c) A normal human sperm (22 + Y) fertilises an ovum with karyotype '22 +XX'. Name the disorder the offspring thus produced would suffer from and write any two symptoms of the disorder. (2)

OR

(c) Name the best-known and most common autosomal aneuploid abnormality in humans and write any two symptoms. (2)

Concept: undefined - undefined
Chapter: [4] Principles of Inheritance and Variation
SECTION - E
[5]31
[5]31.a
[3]31.a.1

Explain the monosporic development of the embryo sac in the ovule of an angiosperm.

Concept: undefined - undefined
Chapter: [1] Sexual Reproduction in Flowering Plants
[2]31.a.2

Draw a diagram of the mature embryo sac of an angiospermic ovule and label any four parts in it.

Concept: undefined - undefined
Chapter: [1] Sexual Reproduction in Flowering Plants
OR
[5]31.b
[3]31.b.1

Explain the formation of placenta after the implantation in a human female.

Concept: undefined - undefined
Chapter: [2] Human Reproduction
[2]31.b.2

Draw a diagram showing human foetus within the uterus and label any four, parts in it.

Concept: undefined - undefined
Chapter: [2] Human Reproduction
[5]32
[5]32.a

"It is sometimes observed that the F1 progeny shows a phenotype that resembles both the parents." Explain this type of inheritance using the example of A, B, and O blood groups in human.

Concept: undefined - undefined
Chapter: [4] Principles of Inheritance and Variation
OR
[5]32.b
[1.5]32.b.1

Explain the process of aminoacylation of tRNA and its role in the process of translation.

Concept: undefined - undefined
Chapter: [5] Molecular Basis of Inheritance
[1.5]32.b.2

How does initiation of the translation process occur in prokaryotes? Explain.

Concept: undefined - undefined
Chapter: [5] Molecular Basis of Inheritance
[2]32.b.3

Where are the untranslated regions located on mRNA and why?

Concept: undefined - undefined
Chapter: [5] Molecular Basis of Inheritance
[5]33
[5]33.a

Bioreactors are the containment vehicles of any biotechnology-based production process. For large scale production and for economic reasons the final success of biotechnological process depends on the efficiency of the bioreactor.

Answer the following questions w.r.t. the given paragraph:

  1. List the operational guidelines that must be adhered to so as to achieve optimisation of the bioreactor system. Enlist any four.
  2. Mention the phase of the growth we refer to in the statement "Optimisation of growth and metabolic activity of the cells".
  3. Is the biological product formed in the bioreactor suitable for the intended use immediate? Give reason in support of your answer.
Concept: undefined - undefined
Chapter: [9] Biotechnology - Principles and Processes
OR
[5]33.b
[3]33.b.1

'EcoRI' has played a very significant role in rDNA technology.

  1. Explain the convention for naming EcoRI.
  2. Write the recognition site and the cleavage sites of this restriction endonuclease.
Concept: undefined - undefined
Chapter: [9] Biotechnology - Principles and Processes
[2]33.b.2

What are the protruding and hanging stretches of DNA produced by these restriction enzymes called? Describe their role in the formation of rDNA.

Concept: undefined - undefined
Chapter: [9] Biotechnology - Principles and Processes

Other Solutions





































Submit Question Paper

Help us maintain new question papers on Shaalaa.com, so we can continue to help students




only jpg, png and pdf files

CBSE previous year question papers Class 12 Biology with solutions 2022 - 2023

     CBSE Class 12 question paper solution is key to score more marks in final exams. Students who have used our past year paper solution have significantly improved in speed and boosted their confidence to solve any question in the examination. Our CBSE Class 12 question paper 2023 serve as a catalyst to prepare for your Biology board examination.
     Previous year Question paper for CBSE Class 12 -2023 is solved by experts. Solved question papers gives you the chance to check yourself after your mock test.
     By referring the question paper Solutions for Biology, you can scale your preparation level and work on your weak areas. It will also help the candidates in developing the time-management skills. Practice makes perfect, and there is no better way to practice than to attempt previous year question paper solutions of CBSE Class 12.

How CBSE Class 12 Question Paper solutions Help Students ?
• Question paper solutions for Biology will helps students to prepare for exam.
• Question paper with answer will boost students confidence in exam time and also give you an idea About the important questions and topics to be prepared for the board exam.
• For finding solution of question papers no need to refer so multiple sources like textbook or guides.
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×