Advertisements
Advertisements
Question
What is a cistron?
Advertisements
Solution
APPEARS IN
RELATED QUESTIONS
State the difference between the structural genes in a Transcription Unit of Prokaryotes and Eukaryotes.
Explain (in one or two lines) the function of the following:
Exons
The transcription unit is represented in the diagram given below.
Identify site (i), factor (ii), and Enzyme (iii) responsible for carrying out the process.
The functional unit of DNA molecule that codes for particular gene product is ______.
Exons help in synthesis of ______.
Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene? If yes, how? If not, why so?
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by ______.
Which DNA sequence element is located at the 3' end of a transcription unit and signals the termination of transcription?
Which strand has a polarity of 3' → 5' and serves as the actual template for RNA synthesis?
The Coding Strand is also known by which alternative names?
What is the relationship between the Coding Strand sequence and the mRNA sequence produced during transcription?
With respect to which strand are all coordinates such as 'upstream' and 'downstream' defined in a transcription unit?
The Lac operon in E. coli is an example of which type of mRNA?
Define Introns in the context of eukaryotic split genes.
