English
Karnataka Board PUCPUC Science 2nd PUC Class 12

Explain (in one or two lines) the function of the following: tRNA

Advertisements
Advertisements

Question

Explain (in one or two lines) the function of the following:

tRNA

Explain
Advertisements

Solution

tRNA or transfer RNA is a small RNA that reads the genetic code present on mRNA. It carries specific amino acids to mRNA on ribosomes during the translation of proteins.

shaalaa.com
  Is there an error in this question or solution?
Chapter 5: Molecular Basis of Inheritance - EXERCISES [Page 109]

APPEARS IN

NCERT Biology [English] Class 12
Chapter 5 Molecular Basis of Inheritance
EXERCISES | Q 11. (b) | Page 109
Nootan Biology [English] Class 12 ISC
Chapter 5 Molecular Basis of Inheritance
NCERT EXERCISES | Q 10. | Page 277

RELATED QUESTIONS

State the difference between the structural genes in a Transcription Unit of Prokaryotes and Eukaryotes.


Explain (in one or two lines) the function of the following:

Exons


In split genes, the coding sequence are called ______.


The term gene was coined by ______.


The transcription unit is represented in the diagram given below.

Identify site (i), factor (ii), and Enzyme (iii) responsible for carrying out the process.


The functional unit of DNA molecule that codes for particular gene product is ______.


The equivalent of a structural gene is ______


Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.


Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene? If yes, how? If not, why so?


Which one is the correct product of DNA dependent RNA polymerase to the given template?

3'TACATGGCAAATATCCATTCA5'


Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by ______.


Which DNA sequence element is found at the 5' end of a transcription unit and serves as the binding site for RNA polymerase?


Which DNA sequence element is located at the 3' end of a transcription unit and signals the termination of transcription?


What is the primary function of the Structural Gene within a transcription unit?


The Template Strand is also known by which alternative names?


Which strand has a polarity of 3' → 5' and serves as the actual template for RNA synthesis?


What is the relationship between the Coding Strand sequence and the mRNA sequence produced during transcription?


With respect to which strand are all coordinates such as 'upstream' and 'downstream' defined in a transcription unit?


Which organism type typically produces Polycistronic mRNA?


Define Introns in the context of eukaryotic split genes.


In the context of a transcription unit, how do the Promoter and Terminator work together to regulate the transcription process?


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×