Advertisements
Advertisements
Question
Explain (in one or two lines) the function of the following:
tRNA
Advertisements
Solution
tRNA or transfer RNA is a small RNA that reads the genetic code present on mRNA. It carries specific amino acids to mRNA on ribosomes during the translation of proteins.
APPEARS IN
RELATED QUESTIONS
What is a cistron?
Explain (in one or two lines) the function of the following:
Exons
In split genes, the coding sequence are called ______.
The correct sequence of gene expression is:
- Formation of the primary transcript
- Regulation of splicing
- Transport of mRNA from the nucleus to the cytoplasm
- Translation
Gene is:
The functional unit of DNA molecule that codes for particular gene product is ______.
Exons help in synthesis of ______.
The equivalent of a structural gene is ______
Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
In prokaryotes, which of the following DNA sequences is typically found in the promoter region?
Which DNA sequence element is located at the 3' end of a transcription unit and signals the termination of transcription?
What is the primary function of the Structural Gene within a transcription unit?
Which strand has a polarity of 3' → 5' and serves as the actual template for RNA synthesis?
With respect to which strand are all coordinates such as 'upstream' and 'downstream' defined in a transcription unit?
Which organism type typically produces Polycistronic mRNA?
Define Introns in the context of eukaryotic split genes.
In the context of a transcription unit, how do the Promoter and Terminator work together to regulate the transcription process?
