Advertisements
Advertisements
Question
Explain (in one or two lines) the function of the following:
tRNA
Advertisements
Solution
tRNA or transfer RNA is a small RNA that reads the genetic code present on mRNA. It carries specific amino acids to mRNA on ribosomes during the translation of proteins.
APPEARS IN
RELATED QUESTIONS
What is a cistron?
State the difference between the structural genes in a Transcription Unit of Prokaryotes and Eukaryotes.
Explain (in one or two lines) the function of the following:
Exons
The correct sequence of gene expression is:
- Formation of the primary transcript
- Regulation of splicing
- Transport of mRNA from the nucleus to the cytoplasm
- Translation
The term gene was coined by ______.
The transcription unit is represented in the diagram given below.
Identify site (i), factor (ii), and Enzyme (iii) responsible for carrying out the process.
Gene is:
The functional unit of DNA molecule that codes for particular gene product is ______.
Exons help in synthesis of ______.
The equivalent of a structural gene is ______
Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene? If yes, how? If not, why so?
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by ______.
