Advertisements
Advertisements
Question
Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.
Advertisements
Solution
Portion of DNA having information for an entire polypeptide or trait is called cistron. However, by defining a cistron as a segment of DNA coding for a polypeptide, the structural gene in a transcription unit could be said as monocistronic (mostly in eukaryotes) or polycistronic (mostly in bacteria or prokaryotes). In eukaryotes, the monocistronic structural genes have interrupted coding sequences—the genes in eukaryotes are split.
The coding sequences or expressed sequences are defined as exons. Exons are said to be those sequence that appear in mature or processed RNA. The exons are interrupted by introns. Introns or intervening sequences do not appear in mature or processed RNA.
APPEARS IN
RELATED QUESTIONS
What is a cistron?
State the difference between the structural genes in a Transcription Unit of Prokaryotes and Eukaryotes.
Explain (in one or two lines) the function of the following:
tRNA
Explain (in one or two lines) the function of the following:
Exons
The correct sequence of gene expression is:
- Formation of the primary transcript
- Regulation of splicing
- Transport of mRNA from the nucleus to the cytoplasm
- Translation
The term gene was coined by ______.
The transcription unit is represented in the diagram given below.
Identify site (i), factor (ii), and Enzyme (iii) responsible for carrying out the process.
Gene is:
Exons help in synthesis of ______.
The equivalent of a structural gene is ______
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene? If yes, how? If not, why so?
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by ______.
