Advertisements
Advertisements
प्रश्न
Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.
Advertisements
उत्तर
Portion of DNA having information for an entire polypeptide or trait is called cistron. However, by defining a cistron as a segment of DNA coding for a polypeptide, the structural gene in a transcription unit could be said as monocistronic (mostly in eukaryotes) or polycistronic (mostly in bacteria or prokaryotes). In eukaryotes, the monocistronic structural genes have interrupted coding sequences—the genes in eukaryotes are split.
The coding sequences or expressed sequences are defined as exons. Exons are said to be those sequence that appear in mature or processed RNA. The exons are interrupted by introns. Introns or intervening sequences do not appear in mature or processed RNA.
APPEARS IN
संबंधित प्रश्न
What is a cistron?
State the difference between the structural genes in a Transcription Unit of Prokaryotes and Eukaryotes.
Explain (in one or two lines) the function of the following:
tRNA
The term gene was coined by ______.
The transcription unit is represented in the diagram given below.
Identify site (i), factor (ii), and Enzyme (iii) responsible for carrying out the process.
Gene is:
Exons help in synthesis of ______.
The equivalent of a structural gene is ______
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
Which DNA sequence element is located at the 3' end of a transcription unit and signals the termination of transcription?
The Coding Strand is also known by which alternative names?
Which organism type typically produces Polycistronic mRNA?
The Lac operon in E. coli is an example of which type of mRNA?
Define Introns in the context of eukaryotic split genes.
In the context of a transcription unit, how do the Promoter and Terminator work together to regulate the transcription process?
