Advertisements
Advertisements
प्रश्न
Explain (in one or two lines) the function of the following:
Exons
Advertisements
उत्तर
DNA in eukaryotes is a mosaic of exons and introns. Exons are coding sequences in DNA that are both transcribed and translated.
APPEARS IN
संबंधित प्रश्न
What is a cistron?
State the difference between the structural genes in a Transcription Unit of Prokaryotes and Eukaryotes.
Explain (in one or two lines) the function of the following:
tRNA
In split genes, the coding sequence are called ______.
The correct sequence of gene expression is:
- Formation of the primary transcript
- Regulation of splicing
- Transport of mRNA from the nucleus to the cytoplasm
- Translation
The term gene was coined by ______.
The transcription unit is represented in the diagram given below.

Identify site (i), factor (ii), and Enzyme (iii) responsible for carrying out the process.
The functional unit of DNA molecule that codes for particular gene product is ______.
Exons help in synthesis of ______.
The equivalent of a structural gene is ______
Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene? If yes, how? If not, why so?
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
