Advertisements
Advertisements
प्रश्न
Explain (in one or two lines) the function of the following:
Exons
Advertisements
उत्तर
DNA in eukaryotes is a mosaic of exons and introns. Exons are coding sequences in DNA that are both transcribed and translated.
APPEARS IN
संबंधित प्रश्न
What is a cistron?
State the difference between the structural genes in a Transcription Unit of Prokaryotes and Eukaryotes.
Explain (in one or two lines) the function of the following:
tRNA
The term gene was coined by ______.
The transcription unit is represented in the diagram given below.
Identify site (i), factor (ii), and Enzyme (iii) responsible for carrying out the process.
The equivalent of a structural gene is ______
Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene? If yes, how? If not, why so?
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by ______.
A transcription unit is defined by three structural regions. Which of the following correctly lists these three regions in their proper order from 5' to 3' on the coding strand?
In prokaryotes, which of the following DNA sequences is typically found in the promoter region?
Which DNA sequence element is located at the 3' end of a transcription unit and signals the termination of transcription?
What is the primary function of the Structural Gene within a transcription unit?
The Template Strand is also known by which alternative names?
Which strand has a polarity of 3' → 5' and serves as the actual template for RNA synthesis?
What is the relationship between the Coding Strand sequence and the mRNA sequence produced during transcription?
With respect to which strand are all coordinates such as 'upstream' and 'downstream' defined in a transcription unit?
Which organism type typically produces Polycistronic mRNA?
The Lac operon in E. coli is an example of which type of mRNA?
Define Introns in the context of eukaryotic split genes.
In the context of a transcription unit, how do the Promoter and Terminator work together to regulate the transcription process?
