Advertisements
Advertisements
प्रश्न
What is a cistron?
Advertisements
उत्तर
APPEARS IN
संबंधित प्रश्न
Explain (in one or two lines) the function of the following:
tRNA
The correct sequence of gene expression is:
- Formation of the primary transcript
- Regulation of splicing
- Transport of mRNA from the nucleus to the cytoplasm
- Translation
The term gene was coined by ______.
Exons help in synthesis of ______.
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
A transcription unit is defined by three structural regions. Which of the following correctly lists these three regions in their proper order from 5' to 3' on the coding strand?
Which DNA sequence element is found at the 5' end of a transcription unit and serves as the binding site for RNA polymerase?
In prokaryotes, which of the following DNA sequences is typically found in the promoter region?
Which DNA sequence element is located at the 3' end of a transcription unit and signals the termination of transcription?
The Template Strand is also known by which alternative names?
Which strand has a polarity of 3' → 5' and serves as the actual template for RNA synthesis?
What is the relationship between the Coding Strand sequence and the mRNA sequence produced during transcription?
Which organism type typically produces Polycistronic mRNA?
The Lac operon in E. coli is an example of which type of mRNA?
Define Introns in the context of eukaryotic split genes.
In the context of a transcription unit, how do the Promoter and Terminator work together to regulate the transcription process?
