Advertisements
Advertisements
प्रश्न
State the difference between the structural genes in a Transcription Unit of Prokaryotes and Eukaryotes.
Advertisements
उत्तर १
In prokaryotes, the structural genes are polycistronic and continuous, whereas in eukaryotes, the structural genes are monocistronic and split.
In prokaryotes, there is a single DNA-dependent RNA polymerase which synthesises all the types of RNAs (mRNA, tRNA and rRNA), whereas eukaryotes have three RNA polymerases − Pol I, Pol II, and Pol III − to synthesise different types of RNAs.
उत्तर २
संबंधित प्रश्न
What is a cistron?
Explain (in one or two lines) the function of the following:
tRNA
Explain (in one or two lines) the function of the following:
Exons
In split genes, the coding sequence are called ______.
The correct sequence of gene expression is:
- Formation of the primary transcript
- Regulation of splicing
- Transport of mRNA from the nucleus to the cytoplasm
- Translation
The term gene was coined by ______.
The transcription unit is represented in the diagram given below.

Identify site (i), factor (ii), and Enzyme (iii) responsible for carrying out the process.
Gene is:
The functional unit of DNA molecule that codes for particular gene product is ______.
Exons help in synthesis of ______.
The equivalent of a structural gene is ______
Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene? If yes, how? If not, why so?
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
