Advertisements
Advertisements
प्रश्न
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene? If yes, how? If not, why so?
Advertisements
उत्तर
Functional mRNA of structural genes need not always include all of its exons. This alternate splicing of exons is sex-specific, tissue-specific, and even developmental stage-specific. By such alternate splicing of exons, a single gene may encode for several isoproteins and/or proteins of similar class. In absence of such a kind of splicing, there should have been new genes for every protein/isoprotein. Such an extravagancy has been avoided in natural phenomena by way of altemate splicing.
APPEARS IN
संबंधित प्रश्न
What is a cistron?
Explain (in one or two lines) the function of the following:
tRNA
Explain (in one or two lines) the function of the following:
Exons
In split genes, the coding sequence are called ______.
The correct sequence of gene expression is:
- Formation of the primary transcript
- Regulation of splicing
- Transport of mRNA from the nucleus to the cytoplasm
- Translation
The term gene was coined by ______.
The transcription unit is represented in the diagram given below.
Identify site (i), factor (ii), and Enzyme (iii) responsible for carrying out the process.
Gene is:
The equivalent of a structural gene is ______
Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
A transcription unit is defined by three structural regions. Which of the following correctly lists these three regions in their proper order from 5' to 3' on the coding strand?
The Template Strand is also known by which alternative names?
Which strand has a polarity of 3' → 5' and serves as the actual template for RNA synthesis?
The Coding Strand is also known by which alternative names?
The Lac operon in E. coli is an example of which type of mRNA?
Define Introns in the context of eukaryotic split genes.
In the context of a transcription unit, how do the Promoter and Terminator work together to regulate the transcription process?
