Advertisements
Advertisements
Question
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene? If yes, how? If not, why so?
Advertisements
Solution
Functional mRNA of structural genes need not always include all of its exons. This alternate splicing of exons is sex-specific, tissue-specific, and even developmental stage-specific. By such alternate splicing of exons, a single gene may encode for several isoproteins and/or proteins of similar class. In absence of such a kind of splicing, there should have been new genes for every protein/isoprotein. Such an extravagancy has been avoided in natural phenomena by way of altemate splicing.
APPEARS IN
RELATED QUESTIONS
What is a cistron?
Explain (in one or two lines) the function of the following:
tRNA
In split genes, the coding sequence are called ______.
The correct sequence of gene expression is:
- Formation of the primary transcript
- Regulation of splicing
- Transport of mRNA from the nucleus to the cytoplasm
- Translation
The term gene was coined by ______.
The functional unit of DNA molecule that codes for particular gene product is ______.
Exons help in synthesis of ______.
Define a cistron. Giving examples differentiate between monocistronic and polycistronic transcription unit.
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
A transcription unit is defined by three structural regions. Which of the following correctly lists these three regions in their proper order from 5' to 3' on the coding strand?
Which DNA sequence element is found at the 5' end of a transcription unit and serves as the binding site for RNA polymerase?
What is the primary function of the Structural Gene within a transcription unit?
The Template Strand is also known by which alternative names?
Which strand has a polarity of 3' → 5' and serves as the actual template for RNA synthesis?
The Coding Strand is also known by which alternative names?
What is the relationship between the Coding Strand sequence and the mRNA sequence produced during transcription?
