Science (English Medium)
Academic Year: 2022-2023
Date & Time: 16th March 2023, 10:30 am
Duration: 3h
Advertisements
General Instructions:
Read the following instructions very carefully and strictly follow them:
- This question paper contains 33 questions. All questions are compulsory.
- Question paper is divided into FIVE sections - Section A, B, C, D and E.
- Section A - question number 1 to 16 are Multiple Choice (MCQ) type questions carrying 1 mark each.
- Section B - question number 17 to 21 are Very Short Answer (VSA) type questions carrying 2 marks each.
- Section C - question number 22 to 28 are Short Answer (SA) type questions carrying 3 marks each.
- Section D - question number 29 and 30 are case-based questions carrying 4 marks each. Each question has subparts with internal choice in one subpart.
- Section E - question number 31 to 33 are Long Answer (LA) type questions carrying 5 marks each.
- There is no overall choice. However, an internal choice has been provided in 1 question in Section B, 1 question in Section C, 2 questions in Section D and 1 question in Section E. A candidate has to attempt only one of the alternatives in such questions.
- Wherever necessary, neat and properly labelled diagrams should be drawn.
At which stage during evolution did human use hides to protect their bodies and buried their dead?
Homo habilis
Neanderthal man
Java man
Homo erectus
Chapter: [6] Evolution
Given below are Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART:
| Column A | Column B | ||
| S. No. | Names of ART | S. No. | Procedures |
| (A) | GIFT | (i) | Transfer of ovum from a donor into the fallopian tube of another female. |
| (B) | ICSI | (ii) | Transfer of semen from the donor into the vagina of the female. |
| (C) | ZIFT | (iii) | Injecting sperm directly into the ovum. |
| (D) | IUI | (iv) | Transfer of early embryos into the fallopian tube. |
Choose the option where ART correctly matches with the procedure.
(A)-(i), B-(ii), (C)-(iii), (D)-(iv)
(A)-(iv), B-(i), (C)-(ii), (D)-(iii)
(A)-(iv), B-(iii), (C)-(i), (D)-(ii)
(A)-(i), B-(iii), (C)-(iv), (D)-(ii)
Chapter: [3] Reproductive Health
The decrease in the T-lymphocyte count in human blood will result in ______.
Decrease in antigens
Decrease in antibodies
Increase in antibodies
Increase in antigens
Chapter:
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Phenylalanine, Methionine
Cysteine, Glycine
Alanine, Proline
Serine, Valine
Chapter: [5] Molecular Basis of Inheritance
A Tight one-to-one relationship between many species of fig tree and certain wasps is an example of ______.
Commensalism
Parasitism
Amensalism
Mutualism
Chapter: [11] Organisms and Populations
Select the pathogen mismatched with the symptoms of disease caused by it from the list given below:
Entamoeba histolytica: Constipation, abdominal pain
Epidermophyton: Dry scaly lesions on nail
Wuchereria bancrofti: Chronic inflammation of lymphatic vessels of lower limb
Haemophilus influenzae: Blockage of the intestinal passage
Chapter:
The primary productivity in an ecosystem is expressed as ______.
- gm-2 yr-1
- gm-2 yr
- Kcal m-2 yr-1
- Kcal m-2
Chapter: [12] Ecosystem
Given below is the restriction site of a restriction endonuclease Pst-I and the cleavage sites on a DNA molecule.
\[\ce{5' C - T - G - C - A \overset{\downarrow}{-}{G 3'}}\]
\[\ce{3' G\underset{\uparrow}{-} A - C - G - T - C 5'}\]
Choose the option that gives the correct resultant fragments by the action of the enzyme Pst-I.
| 5' C - T - G | C - A - G 3' |
| 3' G - A - C - G - T | C 5' |
| 5' C - T | G - C - A - G 3' |
| 3' G - A - G - C | T - C 5' |
| 5' C - T - G - C | A - G 3' |
| 3' G - A - C - G | T - C 5' |
| 5' C - T - G - C - A | G 3' |
| 3' G | A - C - G - T - C 5' |
Chapter: [9] Biotechnology - Principles and Processes
The IUCN Red Data List (2004) in the last 500 years documents the extinction of nearly 784 species including ______.
330 invertebrates
338 invertebrates
359 invertebrates
362 invertebrates
Chapter: [13] Biodiversity and Its Conservation
Given below are the list of the commercially important products and their source organisms. Select the option that gives the correct matches.
| List A | List B | ||
| S. No. | Bioactive Products | S. No. |
Microbes (Source Organism) |
| (A) | Cyclosporin - A | (i) | Streptococcus |
| (B) | Statins | (ii) | Trichoderma polysporum |
| (C) | Streptokinase | (iii) | Penicillium notatum |
| (D) | Penicillin | (iv) | Monascus purpureus |
(A) - (i), B - (ii), (C) - (iii), (D) - (iv)
(A) - (iii), B - (iv), (C) - (ii), (D) - (i)
(A) - (iv), B - (iii), (C) - (ii), (D) - (i)
(A) - (ii), B - (iv), (C) - (i), (D) - (iii)
Chapter: [8] Microbes in Human Welfare
Important attributes belonging to a population but not to an individual are:
- Birth rate and death rate
- Male and female
- Birth and death
- Sex-ratio
Select the correct option from the given options:
(i) only
(ii) only
(ii) and (iii)
(i) and (iv)
Chapter: [11] Organisms and Populations
Select the option that shows the correctly identified 'U', 'X', 'Y' and 'Z' in a developing dicot embryo.

X - Plumule (2n), Y - Suspensor (n), Z - Cotyledon (2n), U - Radicle (2n).
X - Plumule (2n), Y - Suspensor (2n), Z- Radicle (2n), U - Cotyledon (2n).
X - Suspensor (2n), Y - Cotyledon (2n), Z - Radicle (2n), U - Plumule (2n).
X - Cotyledon (2n), Y - Radicle (n), Z - Plumule (n), U - Suspensor (n).
Chapter:
Assertion (A): Determining the sex of an unborn child followed by MTP is an illegal practice.
Reason (R): Amniocentesis is a practice to test the presence of genetic disorders also.
Both (A) and (R) are true and (R) is the correct explanation of (A)
Both (A) and (R) are true, but (R) is not the correct explanation of (A)
(A) is true, but (R) is false
(A) is false, but (R) is true
Chapter: [3] Reproductive Health
Assertion (A): Synthetic oligonucleotide polymers are used during Annealing in a PCR.
Reason (R): The primers bind to the double stranded DNA at their complementary regions.
Both (A) and (R) are true and (R) is the correct explanation of (A)
Both (A) and (R) are true, but (R) is not the correct explanation of (A)
(A) is true, but (R) is false
(A) is false, but (R) is true
Chapter: [9] Biotechnology - Principles and Processes
Assertion (A): Decomposition process is slower if detritus is rich in lignin and cutin.
Reason (R): Decomposition is largely an oxygen requiring process.
Both (A) and (R) are true and (R) is the correct explanation of (A)
Both (A) and (R) are true, but (R) is not the correct explanation of (A)
(A) is true, but (R) is false
(A) is false, but (R) is true
Chapter: [12] Ecosystem
Assertion (A): In Thalassemia an abnormal myoglobin chain is synthesized due to a gene defect.
Reason (R): α-Thalassemia is controlled by genes HBA-1 and HBA-2 on chromosome 16.
Both (A) and (R) are true and (R) is the correct explanation of (A)
Both (A) and (R) are true, but (R) is not the correct explanation of (A)
(A) is true, but (R) is false
(A) is false, but (R) is true
Chapter:
The graph given below shows the number of primordial follicles per ovary in women at different ages. Study the graph and answer the questions that follow.

- What is the average age of the women at the onset of menopause?
- At what age are maximum primordial follicles present in the ovary, according to the given graph?
Chapter: [2] Human Reproduction
"Cattle and goats do not browse the Calotropis plant." Justify the statement giving reasons.
Chapter: [11] Organisms and Populations
Advertisements
By using Punnett square depict the genotypes and phenotypes of test crosses (where green pod colour (G) is dominant over yellow pod colour (g)) in Garden pea with unknown genotype.
Chapter: [4] Principles of Inheritance and Variation
- Give an example of a genus of virus used as narrow spectrum insecticidal biocontrol agent.
- How does its use serve as an aid in overall integrated pest management programme?
Chapter: [8] Microbes in Human Welfare
Why is a malignant tumour considered to be more damaging than a benign tumour? Explain.
Chapter: [7] Human Health and Diseases
Write the scientific name of the source organism of the thermostable DNA polymerase used in PCR.
Chapter: [9] Biotechnology - Principles and Processes
State the advantage of using Thermostable DNA polymerase.
Chapter: [9] Biotechnology - Principles and Processes
Name and explain a surgical contraceptive method that can be adopted by the male partner of a couple.
Chapter: [3] Reproductive Health
Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.
Enlist any four prime goals of HGP.
Chapter: [5] Molecular Basis of Inheritance
Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.
Name any one common non-human animal model organism which has also been sequenced thereafter.
Chapter: [5] Molecular Basis of Inheritance
Industrial melanism in England after 1850 is an excellent example of Natural selection. Explain how?
Chapter:
One of the major approaches of crop improvement programme is Artificial Hybridisation. Explain the steps involved in making sure that only the desired pollen grain pollinate the stigma of a bisexual flower by a plant breeder.
Chapter: [1] Sexual Reproduction in Flowering Plants
“Plasmodium protozoan needs both a mosquito and a human host for its continuity.” Explain.
Chapter:
We all must work towards maintaining good health because ‘health is wealth'. Enlist any six ways of achieving good health.
Chapter:
On spraying Bacillus thuringiensis on an infected cotton crop field the pests are killed by the toxin, however the toxin although produced by the bacteria does not affect it. Explain giving reason.
Chapter:
Advertisements
"Biodiversity plays a major role in many ecosystem services that nature provides."
Describe any two broadly utilitarian arguments to justify the given statement.
Chapter: [13] Biodiversity and Its Conservation
"Biodiversity plays a major role in many ecosystem services that nature provides."
State one ethical reason for conserving biodiversity.
Chapter: [13] Biodiversity and Its Conservation
| When a microorganism invades a host, a definite sequence of events usually occurs leading to infection and disease, causing suffering to the host. This process is called pathogenesis. Once a microorganism overcomes the defence system of the host, development of the disease follows a certain sequence of events as shown in the graph. Study the graph given below for the sequence of events leading to the appearance of a disease and answer the questions that follow: |

(a) In which period, according to the graph there are maximum chances of a person transmitting a disease/infection and why? (1)
(b) Study the graph and write what is an incubation period. Name a sexually transmitted disease that can be easily transmitted during this period. Name the specific type of lymphocytes that are attacked by the pathogen of this disease. (2)
OR
(b) Draw a schematic labelled diagram of an antibody. (2)
(c) In which period, the number of immune cells forming antibodies will be the highest in a person suffering from pneumonia? Name the immune cells that produce antibodies. (1)
Chapter:
|
The chromosome number is fixed for all normal organisms leading to species specification whereas any abnormality in the chromosome number of an organism results into abnormal individuals. For example, in humans, 46 is the fixed number of chromosomes both male and female. In males it is '44 + XY' and in females, it is '44 +XX'. Thus the human male is heterogametic, in other words produces two different types of gametes one with '22 + X' chromosomes and the other with '22 + Y' chromosomes respectively. Human female, on the other hand, is homo gametic i.e. produce only one type of gamete with '22 + X' chromosomes only. Sometimes an error may occur during the meiosis of the cell cycle, where the sister chromatids fail to segregate called nondisjunction, leading to the production of abnormal gametes with altered chromosome numbers. On fertilisation, such gametes develop into abnormal individuals. |
(a) State what is aneuploidy. (1)
(b) If during spermatogenesis, the chromatids of sex chromosomes fail to segregate during meiosis, write only the different types of gametes with altered chromosome numbers that could possibly be produced. (1)
(c) A normal human sperm (22 + Y) fertilises an ovum with karyotype '22 +XX'. Name the disorder the offspring thus produced would suffer from and write any two symptoms of the disorder. (2)
OR
(c) Name the best-known and most common autosomal aneuploid abnormality in humans and write any two symptoms. (2)
Chapter: [4] Principles of Inheritance and Variation
Explain the monosporic development of the embryo sac in the ovule of an angiosperm.
Chapter: [1] Sexual Reproduction in Flowering Plants
Draw a diagram of the mature embryo sac of an angiospermic ovule and label any four parts in it.
Chapter: [1] Sexual Reproduction in Flowering Plants
Explain the formation of placenta after the implantation in a human female.
Chapter: [2] Human Reproduction
Draw a diagram showing human foetus within the uterus and label any four, parts in it.
Chapter: [2] Human Reproduction
Name and describe the steps involved in the technique widely used in forensics that serves as the basis of paternity testing in case of disputes.
Chapter:
It is sometimes observed that the F1 progeny has a phenotype that does not resemble either of the two parents and has an intermediate phenotype. Explain by taking a suitable example and working out the cross upto F2 progeny.
Chapter:
Bioreactors are the containment vehicles of any biotechnology-based production process. For large scale production and for economic reasons the final success of biotechnological process depends on the efficiency of the bioreactor.
Answer the following questions w.r.t. the given paragraph:
- List the operational guidelines that must be adhered to so as to achieve optimisation of the bioreactor system. Enlist any four.
- Mention the phase of the growth we refer to in the statement "Optimisation of growth and metabolic activity of the cells".
- Is the biological product formed in the bioreactor suitable for the intended use immediate? Give reason in support of your answer.
Chapter: [9] Biotechnology - Principles and Processes
'EcoRI' has played a very significant role in rDNA technology.
- Explain the convention for naming EcoRI.
- Write the recognition site and the cleavage sites of this restriction endonuclease.
Chapter: [9] Biotechnology - Principles and Processes
What are the protruding and hanging stretches of DNA produced by these restriction enzymes called? Describe their role in the formation of rDNA.
Chapter: [9] Biotechnology - Principles and Processes
Other Solutions
Submit Question Paper
Help us maintain new question papers on Shaalaa.com, so we can continue to help studentsonly jpg, png and pdf files
CBSE previous year question papers Class 12 Biology with solutions 2022 - 2023
Previous year Question paper for CBSE Class 12 -2023 is solved by experts. Solved question papers gives you the chance to check yourself after your mock test.
By referring the question paper Solutions for Biology, you can scale your preparation level and work on your weak areas. It will also help the candidates in developing the time-management skills. Practice makes perfect, and there is no better way to practice than to attempt previous year question paper solutions of CBSE Class 12.
How CBSE Class 12 Question Paper solutions Help Students ?
• Question paper solutions for Biology will helps students to prepare for exam.
• Question paper with answer will boost students confidence in exam time and also give you an idea About the important questions and topics to be prepared for the board exam.
• For finding solution of question papers no need to refer so multiple sources like textbook or guides.
