Advertisements
Advertisements
Question
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
Options
Origin of replication occurs only at the 5’ end of the molecules.
DNA ligase works only in the 3’ → 5’ direction.
DNA polymerase can join new nucleotides only to the 3’ end of the growing strand.
Helicases and single-strand binding proteins that work at the 5’ end.
Advertisements
Solution
DNA polymerase can join new nucleotides only to the 3’ end of the growing strand.
Explanation:
The primary reason for the difference in synthesis is the directional constraint of the enzyme DNA polymerase, which can only add new nucleotides in the 3’ → 5’ direction. Because the two strands of the DNA double helix are antiparallel (running in opposite directions), only one strand, the leading strand, can be synthesised continuously as the replication fork opens. The other strand, known as the lagging strand, must be synthesised in short, discontinuous segments called Okazaki fragments because its template runs in a direction that forces the polymerase to move away from the expanding replication fork to find a free 3’ end.
APPEARS IN
RELATED QUESTIONS
What is the correct sequence of the stages in bacteriophage lytic cycle?
(A) Attachment, Penetration, Lysis, Multiplication
(B) Attachment, Penetration, Multiplication, Lysis
(C) Lysis, Penetration, Multiplication, Attachment
(D) Attachment, Lysis, Multiplication, Penetration
Semiconservative mechanism of DNA was detected using:
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
Describe the process of semiconservative replication of DNA with the help of a neat and labelled diagram.
Okasaki fragments are joined together by ______.
E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?
Which of the following statements is not true about DNA replication in eukaryotes?
From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation?
DNA replication begins at specific sites situated on the molecule. Such sites are called ____________.
Match Column I with Column II and select the correct option among the following.
| Column I | Column II | ||
| i. | DNA replication | a. | RNA polymerase |
| ii. | Translation | b. | DNA polymerase |
| iii. | Transcription | c. | Reverse transcriptase |
| iv. | Reverse transcription | d. | t-RNA- amino acid complex |
Complementary strands of DNA molecule are (i) and bound by (ii).
Read the following statements and select the correct option.
Statement I: DNA replication is continuous on leading strand while on the lagging strand it is discontinuous.
Statement II: DNA polymerase cannot initialize polymerization without a primer.
In DNA molecule, pairing between two complementary nucleotides takes place by ________ bonds.
Extension of the plasma membrane in a prokaryotic cell is ______.
Match the following column.
| Column - I | Column - II |
| (A) DNA structure | 1. Muller and stadder |
| (B) Semiconservative replication of DNA | 2. Beadle and partum |
| (C) One gene-one enzyme theory | 3. Watson and crick |
| (D) Induction of mutation | 4. Massillon and stahl |
Identify the biomolecule that is capable of self-replication.
What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
In eukaryotic organisms, replication of DNA occurs in ______.
