HSC Science Class 12 - Tamil Nadu Board of Secondary Education Question Bank Solutions

Which of the following is the correct sequence of event with reference to the central dogma?

Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'

Write down the sequence of mRNA.

How is the two stage process of protein synthesis advantageous?

Define isolating mechanism and explain its types with suitable examples.

Describe Population Age Distribution.

The use of microorganism metabolism to remove pollutants such as oil spills in the water bodies is known as ____________.

In the E-waste generated by the Mobile Phones, which among the following metal is most abundant?

Discuss the role of an individual to reduce environmental pollution.

How does recycling help reduce pollution?

What is extra chromosomal inheritance?

The first codon to be deciphered was ______ which codes for ______.

Give reasons:

Genetic code is ‘universal’.

Name the anticodon required to recognize the following codon: AAU.

What are the possible risks of GMOs?

Discuss briefly the following:

Ecosan toilets

Name the anticodon required to recognize the following codon: CGA

Name the anticodon required to recognize the following codon: UAU

Name the anticodon required to recognize the following codon: GCA.

Who is the founder of Modern Eugenics movement?