हिंदी
Tamil Nadu Board of Secondary EducationHSC Science कक्षा १२

HSC Science कक्षा १२ - Tamil Nadu Board of Secondary Education Question Bank Solutions

Advertisements
[object Object]
[object Object]
विषयों
मुख्य विषय
अध्याय

Please select a subject first

Advertisements
Advertisements
< prev  4841 to 4860 of 4880  next > 

Which of the following is the correct sequence of event with reference to the central dogma?

[5] Molecular Genetics
Chapter: [5] Molecular Genetics
Concept: undefined >> undefined

Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

[5] Molecular Genetics
Chapter: [5] Molecular Genetics
Concept: undefined >> undefined

Advertisements

If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'

Write down the sequence of mRNA.

[5] Molecular Genetics
Chapter: [5] Molecular Genetics
Concept: undefined >> undefined

How is the two stage process of protein synthesis advantageous?

[5] Molecular Genetics
Chapter: [5] Molecular Genetics
Concept: undefined >> undefined

Define isolating mechanism and explain its types with suitable examples.

[6] Evolution
Chapter: [6] Evolution
Concept: undefined >> undefined

Describe Population Age Distribution.

[11] Organisms and Populations
Chapter: [11] Organisms and Populations
Concept: undefined >> undefined

The use of microorganism metabolism to remove pollutants such as oil spills in the water bodies is known as ____________.

[13] Environmental Issues
Chapter: [13] Environmental Issues
Concept: undefined >> undefined

In the E-waste generated by the Mobile Phones, which among the following metal is most abundant?

[13] Environmental Issues
Chapter: [13] Environmental Issues
Concept: undefined >> undefined

Discuss the role of an individual to reduce environmental pollution.

[13] Environmental Issues
Chapter: [13] Environmental Issues
Concept: undefined >> undefined

How does recycling help reduce pollution?

[13] Environmental Issues
Chapter: [13] Environmental Issues
Concept: undefined >> undefined

What is extra chromosomal inheritance?

[4] Principles of Inheritance and Variation
Chapter: [4] Principles of Inheritance and Variation
Concept: undefined >> undefined

The first codon to be deciphered was ______ which codes for ______.

[5] Molecular Genetics
Chapter: [5] Molecular Genetics
Concept: undefined >> undefined

Give reasons:

Genetic code is ‘universal’.

[5] Molecular Genetics
Chapter: [5] Molecular Genetics
Concept: undefined >> undefined

Name the anticodon required to recognize the following codon: AAU.

[5] Molecular Genetics
Chapter: [5] Molecular Genetics
Concept: undefined >> undefined

What are the possible risks of GMOs?

[10] Applications of Biotechnology
Chapter: [10] Applications of Biotechnology
Concept: undefined >> undefined

Discuss briefly the following:

Ecosan toilets

[13] Environmental Issues
Chapter: [13] Environmental Issues
Concept: undefined >> undefined

Name the anticodon required to recognize the following codon: CGA

[5] Molecular Genetics
Chapter: [5] Molecular Genetics
Concept: undefined >> undefined

Name the anticodon required to recognize the following codon: UAU

[5] Molecular Genetics
Chapter: [5] Molecular Genetics
Concept: undefined >> undefined

Name the anticodon required to recognize the following codon: GCA.

[5] Molecular Genetics
Chapter: [5] Molecular Genetics
Concept: undefined >> undefined

Who is the founder of Modern Eugenics movement?

[4] Principles of Inheritance and Variation
Chapter: [4] Principles of Inheritance and Variation
Concept: undefined >> undefined
< prev  4841 to 4860 of 4880  next > 
Advertisements
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×