English

Science (English Medium) Class 12 - CBSE Question Bank Solutions for Biology

Advertisements
[object Object]
[object Object]
Subjects
Popular subjects
Topics
Advertisements
Advertisements
Biology
< prev  1421 to 1440 of 1531  next > 

Mark the odd one.

[1] Sexual Reproduction in Flowering Plants
Chapter: [1] Sexual Reproduction in Flowering Plants
Concept: undefined >> undefined

The coconut water from tender coconut is ______

[1] Sexual Reproduction in Flowering Plants
Chapter: [1] Sexual Reproduction in Flowering Plants
Concept: undefined >> undefined

Advertisements

Which of the following statements are true related to Seed X and Y?

SEED X SEED Y
  1. Seed X is dicot and endospermic or albuminous.
  2. Seed X is dicot and non-endospermic or non-albuminous.
  3. Seed Y is a monocot and endospermic or albuminous.
  4. Seed Y is a monocot and non-endospermic or non-albuminous.

Choose the correct option with the respect to the nature of the seed.

[1] Sexual Reproduction in Flowering Plants
Chapter: [1] Sexual Reproduction in Flowering Plants
Concept: undefined >> undefined

AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids: 

  Site A Site B
A. UAC Methionine
B. Methionine UAC
C. Methionine AUG
D. AUG Methionine
[5] Molecular Basis of Inheritance
Chapter: [5] Molecular Basis of Inheritance
Concept: undefined >> undefined

Why does the zygote begin to divide only after the division of Primary endosperm cell (PEC)?

[1] Sexual Reproduction in Flowering Plants
Chapter: [1] Sexual Reproduction in Flowering Plants
Concept: undefined >> undefined

What is Down’s syndrome? Give its symptoms and cause. Why is it that the chances of having a child with Down’s syndrome increases if the age of the mother exceeds forty years?

[4] Principles of Inheritance and Variation
Chapter: [4] Principles of Inheritance and Variation
Concept: undefined >> undefined

How was it concluded that genes are located on chromosomes?

[4] Principles of Inheritance and Variation
Chapter: [4] Principles of Inheritance and Variation
Concept: undefined >> undefined

Define aneuploidy. How is it different from polyploidy? Describe the individuals having following chromosomal abnormalities.

  1. Trisomy of 21st Chromosome
  2. XXY
  3. XO
[4] Principles of Inheritance and Variation
Chapter: [4] Principles of Inheritance and Variation
Concept: undefined >> undefined

Which of the following statements is the most appropriate for sickle cell anaemia?

[5] Molecular Basis of Inheritance
Chapter: [5] Molecular Basis of Inheritance
Concept: undefined >> undefined

Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?

[5] Molecular Basis of Inheritance
Chapter: [5] Molecular Basis of Inheritance
Concept: undefined >> undefined

A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.

[5] Molecular Basis of Inheritance
Chapter: [5] Molecular Basis of Inheritance
Concept: undefined >> undefined

There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.

[5] Molecular Basis of Inheritance
Chapter: [5] Molecular Basis of Inheritance
Concept: undefined >> undefined

Discuss the process of translation in detail.

[5] Molecular Basis of Inheritance
Chapter: [5] Molecular Basis of Inheritance
Concept: undefined >> undefined

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

[5] Molecular Basis of Inheritance
Chapter: [5] Molecular Basis of Inheritance
Concept: undefined >> undefined

The chromosome number is fixed for all normal organisms leading to species specification whereas any abnormality in the chromosome number of an organism results into abnormal individuals. For example, in humans, 46 is the fixed number of chromosomes both male and female. In males it is '44 + XY' and in females, it is '44 +XX'. Thus the human male is heterogametic, in other words produces two different types of gametes one with '22 + X' chromosomes and the other with '22 + Y' chromosomes respectively. Human female, on the other hand, is homo gametic i.e. produce only one type of gamete with '22 + X' chromosomes only.

Sometimes an error may occur during the meiosis of the cell cycle, where the sister chromatids fail to segregate called nondisjunction, leading to the production of abnormal gametes with altered chromosome numbers. On fertilisation, such gametes develop into abnormal individuals.

(a) State what is aneuploidy. (1)

(b) If during spermatogenesis, the chromatids of sex chromosomes fail to segregate during meiosis, write only the different types of gametes with altered chromosome numbers that could possibly be produced. (1)

(c) A normal human sperm (22 + Y) fertilises an ovum with karyotype '22 +XX'. Name the disorder the offspring thus produced would suffer from and write any two symptoms of the disorder. (2)

OR

(c) Name the best-known and most common autosomal aneuploid abnormality in humans and write any two symptoms. (2)

[4] Principles of Inheritance and Variation
Chapter: [4] Principles of Inheritance and Variation
Concept: undefined >> undefined

How does smoking tobacco in human lead to oxygen deficiency in their body?

[7] Human Health and Diseases
Chapter: [7] Human Health and Diseases
Concept: undefined >> undefined

Prior to a sports event, blood and urine samples of sports persons are collected for drug tests.

  1. Why is there a need to conduct such tests?
  2. Name the drugs the authorities usually look for.
  3. Write the generic names of two plants from which these drugs are obtained.
[7] Human Health and Diseases
Chapter: [7] Human Health and Diseases
Concept: undefined >> undefined

A team of students are preparing to participate in the interschool sports meet. During a practice session you find some vials with labels of certain cannabinoids.

  1. Will you report to the authorities? Why?
  2. Name of a plant from which such chemicals are obtained.
  3. Write the effect of these chemicals on human body.
[7] Human Health and Diseases
Chapter: [7] Human Health and Diseases
Concept: undefined >> undefined

A group of youth were having a ‘rave party’ in an isolated area and was raided by police. Packets of ‘smack’ and syringes with needles were found littered around.

  1. Why is taking ‘smack’ considered an abuse?
  2. Write the chemical name of ‘smack’ and the name of its source plant.
  3. Syringes and needles used by the youth for taking the drug could prove to be very fatal. Why?
[7] Human Health and Diseases
Chapter: [7] Human Health and Diseases
Concept: undefined >> undefined

You have attended a birthday party hosted by one of your classmates. You found some guests at the party sitting in a corner making a lot of noise and consuming 'something'. After a while one of the boys from the group started screaming, behaving abnormally and sweating profusely. On enquiry you found that the group members were taking drugs.

(a) Would you inform your parents/school authorities ? Yes/No. Give reasons in support of your answer.

(b) Prepare a note to be circulated amongst the schoolmates about the sources and dangers of any two drugs.

(c) Write any two ways that you will suggest to your school principal so as to promote awareness amongst the youth against the use of these drugs.

[7] Human Health and Diseases
Chapter: [7] Human Health and Diseases
Concept: undefined >> undefined
< prev  1421 to 1440 of 1531  next > 
Advertisements
Advertisements
CBSE Science (English Medium) Class 12 Question Bank Solutions
Question Bank Solutions for CBSE Science (English Medium) Class 12 Biology
Question Bank Solutions for CBSE Science (English Medium) Class 12 Chemistry
Question Bank Solutions for CBSE Science (English Medium) Class 12 Computer Science (C++)
Question Bank Solutions for CBSE Science (English Medium) Class 12 Computer Science (Python)
Question Bank Solutions for CBSE Science (English Medium) Class 12 English Core
Question Bank Solutions for CBSE Science (English Medium) Class 12 English Elective - NCERT
Question Bank Solutions for CBSE Science (English Medium) Class 12 Entrepreneurship
Question Bank Solutions for CBSE Science (English Medium) Class 12 Geography
Question Bank Solutions for CBSE Science (English Medium) Class 12 Hindi (Core)
Question Bank Solutions for CBSE Science (English Medium) Class 12 Hindi (Elective)
Question Bank Solutions for CBSE Science (English Medium) Class 12 History
Question Bank Solutions for CBSE Science (English Medium) Class 12 Informatics Practices
Question Bank Solutions for CBSE Science (English Medium) Class 12 Mathematics
Question Bank Solutions for CBSE Science (English Medium) Class 12 Physical Education
Question Bank Solutions for CBSE Science (English Medium) Class 12 Physics
Question Bank Solutions for CBSE Science (English Medium) Class 12 Political Science
Question Bank Solutions for CBSE Science (English Medium) Class 12 Psychology
Question Bank Solutions for CBSE Science (English Medium) Class 12 Sanskrit (Core)
Question Bank Solutions for CBSE Science (English Medium) Class 12 Sanskrit (Elective)
Question Bank Solutions for CBSE Science (English Medium) Class 12 Sociology
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×