Advertisements
Advertisements
Question
Give an example of a codon having a dual function.
Advertisements
Solution
AUG performs a dual function. It codes for methionine (Met) and works as an initiator codon.
RELATED QUESTIONS
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Name the anticodon required to recognize the following codon: CGA
One of the following is true with respect to AUG.
Genetic code is ______.
Khorana first deciphered the triplet codons of ______.
H. J. Muller was awarded Nobel Prize for his ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Select the incorrectly matched pair.
Percentage of mitochondrial DNA in the cell is:
Genetic code translates the language of:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
Frame shift mutations are caused by ______.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Which one of the following is a termination codon?
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
