मराठी

Science (English Medium) इयत्ता १२ - CBSE Important Questions

Advertisements
[object Object]
[object Object]
विषय
मुख्य विषय
अध्याय

Please select a subject first

Advertisements
Advertisements
< prev  401 to 420 of 6272  next > 

Our government has intentionally imposed strict conditions for M.T.P. in our country. Justify giving a reason.

Appears in 3 question papers
Chapter: [3] Reproductive Health
Concept: Concept of Reproductive Health

Write the complete name of the diagnostic test for AIDS.

Appears in 3 question papers
Chapter: [3] Reproductive Health
Concept: Sexually Transmitted Diseases (STD) or Sexually Transmitted Infections (STI)

Given below are Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART:

Column A Column B
S. No. Names of ART S. No. Procedures
(A) GIFT (i) Transfer of ovum from a donor into the fallopian tube of another female.
(B) ICSI (ii) Transfer of semen from the donor into the vagina of the female.
(C) ZIFT (iii) Injecting sperm directly into the ovum.
(D) IUI (iv) Transfer of early embryos into the fallopian tube.

Choose the option where ART correctly matches with the procedure.

Appears in 3 question papers
Chapter: [3] Reproductive Health
Concept: Infertility

Assertion (A): Determining the sex of an unborn child followed by MTP is an illegal practice.

Reason (R): Amniocentesis is a practice to test the presence of genetic disorders also.

Appears in 3 question papers
Chapter: [3] Reproductive Health
Concept: Induced Abortion or Medical Termination of Pregnancy (MTP)

How many chromosomes do drones of honey bees possess?

Appears in 3 question papers
Chapter: [4] Principles of Inheritance and Variation
Concept: Chromosomal Theory of Inheritance

Write the types of sex-determination mechanisms the following crosses show. Give an example of each type.
(i) Female XX with Male XO
(ii) Female ZW with Male ZZ

Appears in 3 question papers
Chapter: [4] Principles of Inheritance and Variation
Concept: Sex Determination

Public all over India is very much concerned about the deteriorating air quality in large parts of North India. Alarmed by this situation the Resident’s Welfare Association of your locality organized an awareness programme entitled “Bury not burn”. They invited you, being a biology student to participate.

  1. How would you justify your arguments that promote burying and discourage burning? (Give two reasons.)
  2. With the help of flow charts, one for each practice depicts the chain of events that follow.
Appears in 3 question papers
Chapter: [4] Environmental Issues
Concept: Effects of Domestic Sewage and Industrial Effluents on Water

The chromosome number is fixed for all normal organisms leading to species specification whereas any abnormality in the chromosome number of an organism results into abnormal individuals. For example, in humans, 46 is the fixed number of chromosomes both male and female. In males it is '44 + XY' and in females, it is '44 +XX'. Thus the human male is heterogametic, in other words produces two different types of gametes one with '22 + X' chromosomes and the other with '22 + Y' chromosomes respectively. Human female, on the other hand, is homo gametic i.e. produce only one type of gamete with '22 + X' chromosomes only.

Sometimes an error may occur during the meiosis of the cell cycle, where the sister chromatids fail to segregate called nondisjunction, leading to the production of abnormal gametes with altered chromosome numbers. On fertilisation, such gametes develop into abnormal individuals.

(a) State what is aneuploidy. (1)

(b) If during spermatogenesis, the chromatids of sex chromosomes fail to segregate during meiosis, write only the different types of gametes with altered chromosome numbers that could possibly be produced. (1)

(c) A normal human sperm (22 + Y) fertilises an ovum with karyotype '22 +XX'. Name the disorder the offspring thus produced would suffer from and write any two symptoms of the disorder. (2)

OR

(c) Name the best-known and most common autosomal aneuploid abnormality in humans and write any two symptoms. (2)

Appears in 3 question papers
Chapter: [4] Principles of Inheritance and Variation
Concept: Human Genetic Disorders >> Chromosomal Disorders or Abnormalities

What is a cistron?

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Protein Synthesis >> Transcription Unit and the Gene

(i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Protein Synthesis >> Transcription

Name the transcriptionally active region of chromatin in a nucleus.

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Packaging of DNA Helix

Explain the process of making heterogeneous nuclear RNA (hnRNA) into a fully functional mRNA in eukaryotes. Where does this process occur in the cell?

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Protein Synthesis >> Process of Transcription in Bacteria

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Genetic Code

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Enlist any four prime goals of HGP.

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Human Genome Project

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Name any one common non-human animal model organism which has also been sequenced thereafter.

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Human Genome Project

What does the following equation represent? Explain:

p2 + 2pq + q2 = 1.

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Hardy Weinberg’s Principle

Mention the evolutionary significance of the Shrews

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Evolution of Life Forms - a Theory

Mention the evolutionary significance of the Lobefins

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Evolution of Life Forms - a Theory

Mention the evolutionary significance of the Homo habilis

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Evolution of Life Forms - a Theory

p2 + 2pq + q2 = 1. Explain this algebraic equation on the basis of Hardy Weinberg's principle.

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Hardy Weinberg’s Principle
< prev  401 to 420 of 6272  next > 
Advertisements
Advertisements
CBSE Science (English Medium) इयत्ता १२ Important Questions
Important Questions for CBSE Science (English Medium) इयत्ता १२ Biology
Important Questions for CBSE Science (English Medium) इयत्ता १२ Chemistry
Important Questions for CBSE Science (English Medium) इयत्ता १२ Computer Science (C++)
Important Questions for CBSE Science (English Medium) इयत्ता १२ Computer Science (Python)
Important Questions for CBSE Science (English Medium) इयत्ता १२ English Core
Important Questions for CBSE Science (English Medium) इयत्ता १२ English Elective - NCERT
Important Questions for CBSE Science (English Medium) इयत्ता १२ Entrepreneurship
Important Questions for CBSE Science (English Medium) इयत्ता १२ Geography
Important Questions for CBSE Science (English Medium) इयत्ता १२ Hindi (Core)
Important Questions for CBSE Science (English Medium) इयत्ता १२ Hindi (Elective)
Important Questions for CBSE Science (English Medium) इयत्ता १२ History
Important Questions for CBSE Science (English Medium) इयत्ता १२ Informatics Practices
Important Questions for CBSE Science (English Medium) इयत्ता १२ Mathematics
Important Questions for CBSE Science (English Medium) इयत्ता १२ Physical Education
Important Questions for CBSE Science (English Medium) इयत्ता १२ Physics
Important Questions for CBSE Science (English Medium) इयत्ता १२ Political Science
Important Questions for CBSE Science (English Medium) इयत्ता १२ Psychology
Important Questions for CBSE Science (English Medium) इयत्ता १२ Sociology
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×