HSC Science (General) 12th Standard Board Exam - Maharashtra State Board Question Bank Solutions

What is homeostasis?

During the replication of DNA, the separated strands are prevented from recoiling by using ______.

Pick out the appropriate association representing brood parasitism.

What are the effects of biotechnology with relation to human health?

The nucleic acid synthesis takes place in ______.

The interaction between cattle egret and the buffalo is ______.

Explain how imbibition helps root hairs in adsorption of water.

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

What is a connecting link?

Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.

Complete the following chart regarding population interaction and re-write:

Write a note on parasitism.

The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?

Define outcrossing

Name any two disorders of respiratory system.

What are the special adaptations that endoparasites show?

Enzyme involved in synthesis of RNA primer.

Select the statement which best describes parasitism.

In which interaction of species, both the species are at a loss?