English

HSC Science (General) 12th Standard Board Exam - Maharashtra State Board Question Bank Solutions

Advertisements
[object Object]
[object Object]
Subjects
Popular subjects
Topics

Please select a subject first

Advertisements
Advertisements
< prev  521 to 540 of 14017  next > 

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

What is a connecting link?

[5] Origin and Evolution of Life
Chapter: [5] Origin and Evolution of Life
Concept: undefined >> undefined

Advertisements

Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.

[5] Origin and Evolution of Life
Chapter: [5] Origin and Evolution of Life
Concept: undefined >> undefined

Complete the following chart regarding population interaction and re-write:

Sr. No. Name of interaction Interaction between
1. ? Plasmodium and Man
2. ? Leopard and Lion
3. ? Clownfish and Sea-anemone
[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

Write a note on parasitism.

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

Define outcrossing

[11] Enhancement of Food Production
Chapter: [11] Enhancement of Food Production
Concept: undefined >> undefined

Name any two disorders of respiratory system.

[8] Respiration and Circulation
Chapter: [8] Respiration and Circulation
Concept: undefined >> undefined

What are the special adaptations that endoparasites show?

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

Enzyme involved in synthesis of RNA primer.

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

Select the statement which best describes parasitism.

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

In which interaction of species, both the species are at a loss?

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

Adsorption of water by hydrophilic colloids is called______.

[6] Plant Water Relation
Chapter: [6] Plant Water Relation
Concept: undefined >> undefined

What were the control measures taken by Delhi Government for combating air pollution?

[15] Biodiversity, Conservation and Environmental Issues
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Concept: undefined >> undefined

Why do the wooden doors become very hard to close and open in rainy season?

[6] Plant Water Relation
Chapter: [6] Plant Water Relation
Concept: undefined >> undefined

Describe mutualism. 

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

What is differentiation?

[7] Plant Growth and Mineral Nutrition
Chapter: [7] Plant Growth and Mineral Nutrition
Concept: undefined >> undefined

What is redifferentiation?

[7] Plant Growth and Mineral Nutrition
Chapter: [7] Plant Growth and Mineral Nutrition
Concept: undefined >> undefined

Select and rewrite the appropriate disorder of the respiratory system with the given symptom.

Breakdown of alveoli, shortness of breath.

[8] Respiration and Circulation
Chapter: [8] Respiration and Circulation
Concept: undefined >> undefined

Select and rewrite the appropriate disorder of the respiratory system with the given symptom.

Inflammation of the sinuses, mucous discharge.

[8] Respiration and Circulation
Chapter: [8] Respiration and Circulation
Concept: undefined >> undefined
< prev  521 to 540 of 14017  next > 
Advertisements
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×