Please select a subject first
Advertisements
Advertisements
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Concept: undefined >> undefined
What is a connecting link?
Concept: undefined >> undefined
Advertisements
Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.
Concept: undefined >> undefined
Complete the following chart regarding population interaction and re-write:
| Sr. No. | Name of interaction | Interaction between |
| 1. | ? | Plasmodium and Man |
| 2. | ? | Leopard and Lion |
| 3. | ? | Clownfish and Sea-anemone |
Concept: undefined >> undefined
Write a note on parasitism.
Concept: undefined >> undefined
The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?
Concept: undefined >> undefined
Define outcrossing
Concept: undefined >> undefined
Name any two disorders of respiratory system.
Concept: undefined >> undefined
What are the special adaptations that endoparasites show?
Concept: undefined >> undefined
Enzyme involved in synthesis of RNA primer.
Concept: undefined >> undefined
Select the statement which best describes parasitism.
Concept: undefined >> undefined
In which interaction of species, both the species are at a loss?
Concept: undefined >> undefined
Adsorption of water by hydrophilic colloids is called______.
Concept: undefined >> undefined
What were the control measures taken by Delhi Government for combating air pollution?
Concept: undefined >> undefined
Why do the wooden doors become very hard to close and open in rainy season?
Concept: undefined >> undefined
Describe mutualism.
Concept: undefined >> undefined
What is differentiation?
Concept: undefined >> undefined
What is redifferentiation?
Concept: undefined >> undefined
Select and rewrite the appropriate disorder of the respiratory system with the given symptom.
Breakdown of alveoli, shortness of breath.
Concept: undefined >> undefined
Select and rewrite the appropriate disorder of the respiratory system with the given symptom.
Inflammation of the sinuses, mucous discharge.
Concept: undefined >> undefined
