हिंदी

HSC Science (General) १२ वीं कक्षा - Maharashtra State Board Question Bank Solutions

Advertisements
[object Object]
[object Object]
विषयों
मुख्य विषय
अध्याय

Please select a subject first

Advertisements
Advertisements
< prev  501 to 520 of 13994  next > 

Define stenohaline species.

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

What is homeostasis?

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

Advertisements

During the replication of DNA, the separated strands are prevented from recoiling by using ______.

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

Pick out the appropriate association representing brood parasitism.

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

What are the effects of biotechnology with relation to human health?

[12] Biotechnology
Chapter: [12] Biotechnology
Concept: undefined >> undefined

The nucleic acid synthesis takes place in ______.

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

The interaction between cattle egret and the buffalo is ______.

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

Explain how imbibition helps root hairs in adsorption of water.

[6] Plant Water Relation
Chapter: [6] Plant Water Relation
Concept: undefined >> undefined

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

What is a connecting link?

[5] Origin and Evolution of Life
Chapter: [5] Origin and Evolution of Life
Concept: undefined >> undefined

Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.

[5] Origin and Evolution of Life
Chapter: [5] Origin and Evolution of Life
Concept: undefined >> undefined

Complete the following chart regarding population interaction and re-write:

Sr. No. Name of interaction Interaction between
1. ? Plasmodium and Man
2. ? Leopard and Lion
3. ? Clownfish and Sea-anemone
[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

Write a note on parasitism.

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

Define outcrossing

[11] Enhancement of Food Production
Chapter: [11] Enhancement of Food Production
Concept: undefined >> undefined

Name any two disorders of respiratory system.

[8] Respiration and Circulation
Chapter: [8] Respiration and Circulation
Concept: undefined >> undefined

What are the special adaptations that endoparasites show?

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined

Enzyme involved in synthesis of RNA primer.

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

Select the statement which best describes parasitism.

[13] Organisms and Populations
Chapter: [13] Organisms and Populations
Concept: undefined >> undefined
< prev  501 to 520 of 13994  next > 
Advertisements
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×