Please select a subject first
Advertisements
Advertisements
Draw neat and labelled diagram of Replication Fork.
Concept: DNA Replication
Draw a neat and labelled diagram of transcription and processing of hn-RNA
Concept: Protein Synthesis
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
Concept: DNA Replication
Histones are rich in ______.
Concept: Packaging of DNA Helix
During the replication of DNA, the separated strands are prevented from recoiling by using ______.
Concept: DNA Replication
Write the aims of the human genome project.
Concept: Human Genome Project
The nucleic acid synthesis takes place in ______.
Concept: DNA Replication
Describe the process of transcription.
Concept: Protein Synthesis
Distinguish between heterochromatin and euchromatin with reference to staining property and activity.
Concept: Packaging of DNA Helix
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
Concept: DNA Replication
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Concept: DNA Replication
Give the different steps involved in formation of m-RNA from hn-RNA.
Concept: Protein Synthesis
The number of purines in a segment of a DNA molecule is 68. What will be the number of pyrimidines in this segment?
Concept: Chemical Evolution of Life
Give the floral adaptations for chiropterophily.
Concept: Adaptive Radiation
Struggle between cow and cow to get grass is called ______.
Concept: Speciation
In which type of adaptation, forelimbs are modified into wings?
(a) Aquatic adaptations
(b) Volant adaptations
(c) Arboreal adaptations
(d) Cursorial adaptations
Concept: Adaptive Radiation
The connecting link between ‘ape’ and ‘man’ is _______.
(A) Dryopithecus
(B) Australopithecus
(C) Homo erectus
(D) Homo neanderthalensis
Concept: Human Evolution
Explain the concept ‘survival of the fittest’.
Concept: Organic Evolution
Enlist any 'two' floral adaptations in salvia.
Concept: Adaptive Radiation
Give the principles of Darwin's theory of natural selection.
Concept: Darwin’s Theory of Natural Selection (Darwinism)
