English

HSC Science (General) 12th Standard Board Exam - Maharashtra State Board Important Questions

Advertisements
[object Object]
[object Object]
Subjects
Popular subjects
Topics

Please select a subject first

Advertisements
Advertisements
< prev  1221 to 1240 of 5581  next > 

Draw neat and labelled diagram of Replication Fork.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Draw a neat and labelled diagram of transcription and processing of hn-RNA

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Protein Synthesis

How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Histones are rich in ______.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Packaging of DNA Helix

During the replication of DNA, the separated strands are prevented from recoiling by using ______.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Write the aims of the human genome project.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Human Genome Project

The nucleic acid synthesis takes place in ______.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Describe the process of transcription.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Protein Synthesis

Distinguish between heterochromatin and euchromatin with reference to staining property and activity.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Packaging of DNA Helix

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: DNA Replication

Give the different steps involved in formation of m-RNA from hn-RNA.

Appears in 1 question paper
Chapter: [4] Molecular Basis of Inheritance
Concept: Protein Synthesis

The number of purines in a segment of a DNA molecule is 68. What will be the number of pyrimidines in this segment?

Appears in 1 question paper
Chapter: [5] Origin and Evolution of Life
Concept: Chemical Evolution of Life

Give the floral adaptations for chiropterophily.

Appears in 1 question paper
Chapter: [5] Origin and Evolution of Life
Concept: Adaptive Radiation

Struggle between cow and cow to get grass is called ______.

Appears in 1 question paper
Chapter: [5] Origin and Evolution of Life
Concept: Speciation

In which type of adaptation, forelimbs are modified into wings?

(a) Aquatic adaptations

(b) Volant adaptations

(c) Arboreal adaptations

(d) Cursorial adaptations

Appears in 1 question paper
Chapter: [5] Origin and Evolution of Life
Concept: Adaptive Radiation

The connecting link between ‘ape’ and ‘man’ is _______.

(A) Dryopithecus

(B) Australopithecus

(C) Homo erectus

(D) Homo neanderthalensis

Appears in 1 question paper
Chapter: [5] Origin and Evolution of Life
Concept: Human Evolution

Explain the concept ‘survival of the fittest’.

Appears in 1 question paper
Chapter: [5] Origin and Evolution of Life
Concept: Organic Evolution

Enlist any 'two' floral adaptations in salvia.

Appears in 1 question paper
Chapter: [5] Origin and Evolution of Life
Concept: Adaptive Radiation

Give the principles of Darwin's theory of natural selection.

Appears in 1 question paper
Chapter: [5] Origin and Evolution of Life
Concept: Darwin’s Theory of Natural Selection (Darwinism)
< prev  1221 to 1240 of 5581  next > 
Advertisements
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×