HSC Science (General) इयत्ता १२ वी - Maharashtra State Board Important Questions

Draw neat and labelled diagram of Replication Fork.

Draw a neat and labelled diagram of transcription and processing of hn-RNA

How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?

Histones are rich in ______.

During the replication of DNA, the separated strands are prevented from recoiling by using ______.

Write the aims of the human genome project.

The nucleic acid synthesis takes place in ______.

Describe the process of transcription.

Distinguish between heterochromatin and euchromatin with reference to staining property and activity.

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

Give the different steps involved in formation of m-RNA from hn-RNA.

The number of purines in a segment of a DNA molecule is 68. What will be the number of pyrimidines in this segment?

Give the floral adaptations for chiropterophily.

Struggle between cow and cow to get grass is called ______.

In which type of adaptation, forelimbs are modified into wings?

(a) Aquatic adaptations

(b) Volant adaptations

(c) Arboreal adaptations

(d) Cursorial adaptations

The connecting link between ‘ape’ and ‘man’ is _______.

(A) Dryopithecus

(B) Australopithecus

(C) Homo erectus

(D) Homo neanderthalensis

Explain the concept ‘survival of the fittest’.

Enlist any 'two' floral adaptations in salvia.

Give the principles of Darwin's theory of natural selection.