Advertisements
Advertisements
Questions
Draw neat and labelled diagram of Replication Fork.
Draw a labelled schematic sketch of replication fork of DNA.
Advertisements
Solution 1
Solution 2
RELATED QUESTIONS
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
Very Short Answer Question:
Why are Okazaki fragments formed on lagging strand only?
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
What is the function of SSBP?
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation?
______ heavy isotope was used by Meselson and Stahl during their experiment.
E. coli, in which both the strands of DNA are labeled with 15N is transferred to 14N medium and allowed to replicate for three generations. What would be the number of hybrid DNA molecules in the third generation?
For which of the following reason RNA primer is must for initiation of DNA replication?
Identify the CORRECT combination of statements with respect to DNA synthesis.
I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.
II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.
III. DNA polymerases on their own cannot initiate the process of replication.
IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.
Which of the following is the function of single-strand binding proteins?
In a segment of DNA with 10 base pairs, the numbers of sugar molecules are _________.
Okazaki segments are formed during ______.
The nucleic acid synthesis takes place in ______.
In the experiment of Meselson and Stahl, the heavy DNA was separated from light DNA by centrifugation in ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Enzyme involved in synthesis of RNA primer.
