मराठी

Biology Official 2022-2023 HSC Science (General) 12th Standard Board Exam Question Paper Solution

Advertisements
Biology [Official]
Marks: 70 Maharashtra State Board
HSC Science (General)

Academic Year: 2022-2023
Date & Time: 7th March 2023, 11:00 am
Duration: 3h
Advertisements

General instructions :

The question paper is divided into four sections :

  1. Section A: Q. No. 1 contains Ten multiple-choice type of questions carrying One mark each. Q. No. 2 contains Eight very short answer type of questions carrying One mark each.
  2. For each multiple-choice type of question, it is mandatory to write the correct answer along with its alphabet. e.g., (a)......../(b)......../(c)......./(d)........ No marks(s) shall be given if ONLY the correct answer or the alphabet of the correct answer is written. Only the first attempt will be considered for evaluation.
  3. Section B: Q. No. 3 to Q. No. 14 contain Twelve short answer type of questions carrying Two marks each. (Attempt any Eight).
  4. Section C: Q. No. 15 to Q. No. 26 contains Twelve short answer type of questions carrying Three marks each. (Attempt any Eight).
  5. Section D: Q. No. 27 to Q. No. 31 contain Five long answer type of questions carrying Four marks each. (Attempt any Three).
  6. Begin the answer of each section on a new page.
  7. Figures to the right indicate full marks.

SECTION - A
[10]1 | Select and write the correct answers for the following multiple choice type of questions:
[1]1.i

Histones are rich in ______.

alanine and glycine

lysine and arginine

histidine and serine

cysteine and tyrosine

Concept: undefined - undefined
Chapter: [4] Molecular Basis of Inheritance
[1]1.ii

How many mitotic divisions take place during the formation of a female gametophyte from a functional megaspore?

One

Two

Three

Four

Concept: undefined - undefined
Chapter:
[1]1.iii

Which of the following is the only gaseous plant growth regulator?

ABA

Cytokinin

Ethylene

Gibberellin

Concept: undefined - undefined
Chapter: [7] Plant Growth and Mineral Nutrition
[1]1.iv

The pH of nutrient medium for plant tissue culture is in the range of ______.

2 to 4.2

5 to 5.8

7 to 7.5

8 to 9.5

Concept: undefined - undefined
Chapter: [11] Enhancement of Food Production
[1]1.v

Rivet Popper Hypothesis is an analogy to explain the significance of ______.

Biodiversity

natality

sex-ratio

age distribution ratio

Concept: undefined - undefined
Chapter: [15] Biodiversity, Conservation and Environmental Issues
[1]1.vi

Which of the following group shows ZW-ZZ type of sex determination?

Pigeon, Parrot, Sparrow

Parrot, Bat, Fowl

Bat, Fowl, Crow

Sparrow, Fowl, Cat

Concept: undefined - undefined
Chapter: [3] Inheritance and Variation
[1]1.vii

In Hamburger’s phenomenon, ______.

CI‾ diffuse into WBC

CI‾ diffuse into RBCs

Na+ diffuse into RBCs

Na+ diffuse into WBCs

Concept: undefined - undefined
Chapter: [8] Respiration and Circulation
[1]1.viii

Calcium and Phosphate ions are balanced between blood and other tissues by ______.

Thymosin and Parathormone

Calcitonin and Somatostatin

Collip’s hormone and Calcitonin

Calcitonin and Thymosin

Concept: undefined - undefined
Chapter: [9] Control and Co-ordination
[1]1.ix

Identify the INCORRECT statement.

In a flaccid cell, T.P. is zero.

In a turgid cell, DPD is zero.

In a fully turgid cell, TP = OP.

The water potential of pure water is negative.

Concept: undefined - undefined
Chapter: [6] Plant Water Relation
[1]1.x

Which of the following is a hormone-releasing contraceptive?

Cu-T

Cu-7

Multiload-375

LNG-20

Concept: undefined - undefined
Chapter: [2] Reproduction in Lower and Higher Animals
[8]2 | Answer the following questions :
[1]2.i

Which disease is caused by HPV?

Concept: undefined - undefined
Chapter: [10] Human Health and Diseases
[1]2.ii

Which device is used to clean both dust and gases from polluted air?

Concept: undefined - undefined
Chapter: [15] Biodiversity, Conservation and Environmental Issues
[1]2.iii

Mention the name of a sterile animal produced by intergeneric hybridisation.

Concept: undefined - undefined
Chapter: [5] Origin and Evolution of Life
[1]2.iv

Give the name of first transgenic plant.

Concept: undefined - undefined
Chapter:
[1]2.v

A child has low BMR, delayed puberty and mental retardation. Identify the disease.

Concept: undefined - undefined
Chapter: [9] Control and Co-ordination
[1]2.vi

Identify ‘A’ in the given graph of population growth:

Concept: undefined - undefined
Chapter: [13] Organisms and Populations
[1]2.vii

Complete the following box with reference to symptoms of mineral deficiency:

Abscission Pre-mature fall of flowers,
fruits and leaves
______ Appearance of green and
non-green patches on leaves
Concept: undefined - undefined
Chapter: [7] Plant Growth and Mineral Nutrition
[1]2.viii

Give an example of plant having both kidney and dumb-bell shaped guard cells in stomata.

Concept: undefined - undefined
Chapter: [6] Plant Water Relation
SECTION - B : 16 Marks
[2]3 | Attempt any EIGHT questions of the following :
[1]3.i

Define the term:

Gross Primary Productivity

Concept: undefined - undefined
Chapter:
[1]3.ii

Define the term:

Net Primary Productivity

Concept: undefined - undefined
Chapter:
[2]4

Draw a neat diagram of thyroid gland and label thyroid follicle, follicular cells and blood capillaries.

Concept: undefined - undefined
Chapter: [9] Control and Co-ordination
[2]5
[1]5.i

Give a reason – ABA is also known as an antitranspirant.

Concept: undefined - undefined
Chapter: [7] Plant Growth and Mineral Nutrition
[1]5.ii

Explain the role of chlorophyllase enzyme in banana.

Concept: undefined - undefined
Chapter: [7] Plant Growth and Mineral Nutrition
[2]6

Complete the chart showing human proteins produced by rDNA technology to treat human diseases and re-write:

Disorders/diseases Recombinant Proteins
? Erythropoietin
Asthma ?
? Tissue plasminogen activator
Emphysema ?
Concept: undefined - undefined
Chapter:
[2]7
[1]7.i
[0.5]7.i.1

Define the following term:

Imbibition

Concept: undefined - undefined
Chapter: [6] Plant Water Relation
Advertisements
[0.5]7.i.2

Explain the term:

Imbibition

Concept: undefined - undefined
Chapter: [6] Plant Water Relation
[1]7.ii

Explain how imbibition helps root hairs in adsorption of water.

Concept: undefined - undefined
Chapter: [6] Plant Water Relation
[2]8

Draw a neat diagram of the conducting system of human heart and label AV node, Bundle of His and Purkinje fibres.

Concept: undefined - undefined
Chapter: [8] Respiration and Circulation
[2]9

Distinguish between heterochromatin and euchromatin with reference to staining property and activity.

Concept: undefined - undefined
Chapter: [4] Molecular Basis of Inheritance
[2]10

Complete the following chart regarding energy flow in an Ecosystem and re-write:

? Herbivores
Primary Producer ?
? Man, Lion
Secondary consumer ?
Concept: undefined - undefined
Chapter:
[2]11
[1]11.i

What is ‘biofortification’?

Concept: undefined - undefined
Chapter: [11] Enhancement of Food Production
[1]11.ii

Mention one example each of fortification with reference to –

  1. Amino acid content
  2. Vitamin-C content
Concept: undefined - undefined
Chapter: [11] Enhancement of Food Production
[2]12

Differentiate between X-chromosome and Y-chromosome with reference to –

  1. length of non-homologous regions
  2. type as per the position of the centromere
Concept: undefined - undefined
Chapter: [3] Inheritance and Variation
[2]13
[1]13.i

Define the term:

Genetic drift

Concept: undefined - undefined
Chapter: [5] Origin and Evolution of Life
[1]13.ii

Define the term:

Homologous organs

Concept: undefined - undefined
Chapter:
[2]14
[1]14.i

What is ex-situ conservation?

Concept: undefined - undefined
Chapter: [15] Biodiversity, Conservation and Environmental Issues
[1]14.ii

Mention any two places where the ex-situ conservation is undertaken.

Concept: undefined - undefined
Chapter: [15] Biodiversity, Conservation and Environmental Issues
SECTION - C : 24 Marks
[3]15 | Attempt any EIGHT questions of the following:
[1.5]15.i

Define – Incomplete dominance.

Concept: undefined - undefined
Chapter: [3] Inheritance and Variation
[1.5]15.ii

If a red flowered Mirabilis jalapa plant is crossed with a white flowered plant, what will be the phenotypic ratio in F2 generation? Show it by a chart.

Concept: undefined - undefined
Chapter: [3] Inheritance and Variation
[3]16
[1.5]16.i

Differentiate between sympathetic and parasympathetic nervous system with reference to the following:

  1. Pre and post-ganglionic nerve fibres
  2. Effect on heartbeat
Concept: undefined - undefined
Chapter: [9] Control and Co-ordination
[1.5]16.ii

Give reason – All spinal nerves are of mixed type.

Concept: undefined - undefined
Chapter: [9] Control and Co-ordination
[3]17
[1.5]17.i

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.

Concept: undefined - undefined
Chapter: [4] Molecular Basis of Inheritance
[1.5]17.ii

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

Concept: undefined - undefined
Chapter: [4] Molecular Basis of Inheritance
[3]18

Describe the steps in breathing.

Concept: undefined - undefined
Chapter: [8] Respiration and Circulation
[3]19
[1.5]19.i

What is spermatogenesis?

Concept: undefined - undefined
Chapter: [2] Reproduction in Lower and Higher Animals
[1.5]19.ii

Draw a neat and labelled diagram of spermatogenesis.

Concept: undefined - undefined
Chapter: [2] Reproduction in Lower and Higher Animals
[3]20
[1.5]20.i

What is a connecting link?

Concept: undefined - undefined
Chapter: [5] Origin and Evolution of Life
[1.5]20.ii

Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.

Concept: undefined - undefined
Chapter: [5] Origin and Evolution of Life
Advertisements
[3]21

Complete the following chart regarding population interaction and re-write:

Sr. No. Name of interaction Interaction between
1. ? Plasmodium and Man
2. ? Leopard and Lion
3. ? Clownfish and Sea-anemone
Concept: undefined - undefined
Chapter: [13] Organisms and Populations
[3]22
[1.5]22.i

What is the composition of biogas?

Concept: undefined - undefined
Chapter: [11] Enhancement of Food Production
[1.5]22.ii

Mention any four benefits of biogas.

Concept: undefined - undefined
Chapter: [11] Enhancement of Food Production
[3]23
[1.5]23.i

Give reason – Water acts as thermal buffer

Concept: undefined - undefined
Chapter: [6] Plant Water Relation
[1.5]23.ii

Draw a neat and proportionate diagram of root hair and label mitochondria, nucleus and vacuole.

Concept: undefined - undefined
Chapter:
[3]24

Explain three main functions of free antibodies produced by B-lymphocytes.

Concept: undefined - undefined
Chapter:
[3]25
[1.5]25.i

Following are the diagrams of entry of pollen tube into ovule. Identify the type A and B.

Concept: undefined - undefined
Chapter: [1] Reproduction in Lower and Higher Plants
[1.5]25.ii

Give any four points of significance of double fertilization.

Concept: undefined - undefined
Chapter:
[3]26
[1]26.i

Name the hormone that is responsible for apical dominance.

Concept: undefined - undefined
Chapter: [7] Plant Growth and Mineral Nutrition
[1]26.ii

A farmer wants to remove broad-leaved weeds from the jowar plantation in his field. Suggest any plant hormone to remove such weeds.

Concept: undefined - undefined
Chapter: [7] Plant Growth and Mineral Nutrition
[1]26.iii

Mention any two applications of cytokinin.

Concept: undefined - undefined
Chapter: [7] Plant Growth and Mineral Nutrition
SECTION - D : 12 Marks
[4]27 | Attempt any THREE questions of the following :
[1]27.i

What is blood pressure?

Concept: undefined - undefined
Chapter: [8] Respiration and Circulation
[1]27.ii

Give the name of the instrument which is used to measure the blood pressure.

Concept: undefined - undefined
Chapter: [8] Respiration and Circulation
[2]27.iii

Differentiate between an artery and a vein with reference to lumen and thickness of wall.

Concept: undefined - undefined
Chapter: [8] Respiration and Circulation
[4]28
[2]28.i

Describe any three adaptations in anemophilous flowers.

Concept: undefined - undefined
Chapter: [1] Reproduction in Lower and Higher Plants

Mention any one example of the anemophilous flower.

Concept: undefined - undefined
Chapter: [1] Reproduction in Lower and Higher Plants
[2]28.ii

Describe any three adaptations in hydrophilous flowers.

Concept: undefined - undefined
Chapter: [1] Reproduction in Lower and Higher Plants

Mention any one example of the hydrophilous flower.

Concept: undefined - undefined
Chapter: [1] Reproduction in Lower and Higher Plants
[4]29
[2]29.i

What is polymerase chain reaction (PCR)?

Concept: undefined - undefined
Chapter: [12] Biotechnology
[2]29.ii

Describe three steps involved in mechanism of PCR.

Concept: undefined - undefined
Chapter: [12] Biotechnology
[4]30
[2]30.i

Give any four significances of fertilization in humans.

Concept: undefined - undefined
Chapter: [2] Reproduction in Lower and Higher Animals
[2]30.ii

Mention the names of any two organs each derived from ectoderm and mesoderm.

Concept: undefined - undefined
Chapter: [2] Reproduction in Lower and Higher Animals
[4]31
[1]31.i

Give any two functions of cerebellum.

Concept: undefined - undefined
Chapter:
[2]31.ii

Write the names of any four motor cranial nerves with their appropriate serial number.

Concept: undefined - undefined
Chapter: [9] Control and Co-ordination
[1]31.iii

Which hormones stimulate liver for glycogenesis and glycogenolysis?

Concept: undefined - undefined
Chapter: [9] Control and Co-ordination

Submit Question Paper

Help us maintain new question papers on Shaalaa.com, so we can continue to help students




only jpg, png and pdf files

Maharashtra State Board previous year question papers 12th Standard Board Exam Biology with solutions 2022 - 2023

     Maharashtra State Board 12th Standard Board Exam Biology question paper solution is key to score more marks in final exams. Students who have used our past year paper solution have significantly improved in speed and boosted their confidence to solve any question in the examination. Our Maharashtra State Board 12th Standard Board Exam Biology question paper 2023 serve as a catalyst to prepare for your Biology board examination.
     Previous year Question paper for Maharashtra State Board 12th Standard Board Exam Biology-2023 is solved by experts. Solved question papers gives you the chance to check yourself after your mock test.
     By referring the question paper Solutions for Biology, you can scale your preparation level and work on your weak areas. It will also help the candidates in developing the time-management skills. Practice makes perfect, and there is no better way to practice than to attempt previous year question paper solutions of Maharashtra State Board 12th Standard Board Exam.

How Maharashtra State Board 12th Standard Board Exam Question Paper solutions Help Students ?
• Question paper solutions for Biology will helps students to prepare for exam.
• Question paper with answer will boost students confidence in exam time and also give you an idea About the important questions and topics to be prepared for the board exam.
• For finding solution of question papers no need to refer so multiple sources like textbook or guides.
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×