HSC Science (General)
Academic Year: 2022-2023
Date & Time: 7th March 2023, 11:00 am
Duration: 3h
Advertisements
General instructions :
The question paper is divided into four sections :
- Section A: Q. No. 1 contains Ten multiple-choice type of questions carrying One mark each. Q. No. 2 contains Eight very short answer type of questions carrying One mark each.
- For each multiple-choice type of question, it is mandatory to write the correct answer along with its alphabet. e.g., (a)......../(b)......../(c)......./(d)........ No marks(s) shall be given if ONLY the correct answer or the alphabet of the correct answer is written. Only the first attempt will be considered for evaluation.
- Section B: Q. No. 3 to Q. No. 14 contain Twelve short answer type of questions carrying Two marks each. (Attempt any Eight).
- Section C: Q. No. 15 to Q. No. 26 contains Twelve short answer type of questions carrying Three marks each. (Attempt any Eight).
- Section D: Q. No. 27 to Q. No. 31 contain Five long answer type of questions carrying Four marks each. (Attempt any Three).
- Begin the answer of each section on a new page.
- Figures to the right indicate full marks.
Histones are rich in ______.
alanine and glycine
lysine and arginine
histidine and serine
cysteine and tyrosine
Chapter: [4] Molecular Basis of Inheritance
How many mitotic divisions take place during the formation of a female gametophyte from a functional megaspore?
One
Two
Three
Four
Chapter:
Which of the following is the only gaseous plant growth regulator?
ABA
Cytokinin
Ethylene
Gibberellin
Chapter: [7] Plant Growth and Mineral Nutrition
The pH of nutrient medium for plant tissue culture is in the range of ______.
2 to 4.2
5 to 5.8
7 to 7.5
8 to 9.5
Chapter: [11] Enhancement of Food Production
Rivet Popper Hypothesis is an analogy to explain the significance of ______.
Biodiversity
natality
sex-ratio
age distribution ratio
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Which of the following group shows ZW-ZZ type of sex determination?
Pigeon, Parrot, Sparrow
Parrot, Bat, Fowl
Bat, Fowl, Crow
Sparrow, Fowl, Cat
Chapter: [3] Inheritance and Variation
In Hamburger’s phenomenon, ______.
CI‾ diffuse into WBC
CI‾ diffuse into RBCs
Na+ diffuse into RBCs
Na+ diffuse into WBCs
Chapter: [8] Respiration and Circulation
Calcium and Phosphate ions are balanced between blood and other tissues by ______.
Thymosin and Parathormone
Calcitonin and Somatostatin
Collip’s hormone and Calcitonin
Calcitonin and Thymosin
Chapter: [9] Control and Co-ordination
Identify the INCORRECT statement.
In a flaccid cell, T.P. is zero.
In a turgid cell, DPD is zero.
In a fully turgid cell, TP = OP.
The water potential of pure water is negative.
Chapter: [6] Plant Water Relation
Which of the following is a hormone-releasing contraceptive?
Cu-T
Cu-7
Multiload-375
LNG-20
Chapter: [2] Reproduction in Lower and Higher Animals
Which disease is caused by HPV?
Chapter: [10] Human Health and Diseases
Which device is used to clean both dust and gases from polluted air?
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Mention the name of a sterile animal produced by intergeneric hybridisation.
Chapter: [5] Origin and Evolution of Life
A child has low BMR, delayed puberty and mental retardation. Identify the disease.
Chapter: [9] Control and Co-ordination
Identify ‘A’ in the given graph of population growth:

Chapter: [13] Organisms and Populations
Complete the following box with reference to symptoms of mineral deficiency:
| Abscission | Pre-mature fall of flowers, fruits and leaves |
| ______ | Appearance of green and non-green patches on leaves |
Chapter: [7] Plant Growth and Mineral Nutrition
Give an example of plant having both kidney and dumb-bell shaped guard cells in stomata.
Chapter: [6] Plant Water Relation
Draw a neat diagram of thyroid gland and label thyroid follicle, follicular cells and blood capillaries.
Chapter: [9] Control and Co-ordination
Give a reason – ABA is also known as an antitranspirant.
Chapter: [7] Plant Growth and Mineral Nutrition
Explain the role of chlorophyllase enzyme in banana.
Chapter: [7] Plant Growth and Mineral Nutrition
Complete the chart showing human proteins produced by rDNA technology to treat human diseases and re-write:
| Disorders/diseases | Recombinant Proteins |
| ? | Erythropoietin |
| Asthma | ? |
| ? | Tissue plasminogen activator |
| Emphysema | ? |
Chapter:
Define the following term:
Imbibition
Chapter: [6] Plant Water Relation
Advertisements
Explain the term:
Imbibition
Chapter: [6] Plant Water Relation
Explain how imbibition helps root hairs in adsorption of water.
Chapter: [6] Plant Water Relation
Draw a neat diagram of the conducting system of human heart and label AV node, Bundle of His and Purkinje fibres.
Chapter: [8] Respiration and Circulation
Distinguish between heterochromatin and euchromatin with reference to staining property and activity.
Chapter: [4] Molecular Basis of Inheritance
Complete the following chart regarding energy flow in an Ecosystem and re-write:
| ? | Herbivores |
| Primary Producer | ? |
| ? | Man, Lion |
| Secondary consumer | ? |
Chapter:
What is ‘biofortification’?
Chapter: [11] Enhancement of Food Production
Mention one example each of fortification with reference to –
- Amino acid content
- Vitamin-C content
Chapter: [11] Enhancement of Food Production
Differentiate between X-chromosome and Y-chromosome with reference to –
- length of non-homologous regions
- type as per the position of the centromere
Chapter: [3] Inheritance and Variation
Define the term:
Genetic drift
Chapter: [5] Origin and Evolution of Life
What is ex-situ conservation?
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Mention any two places where the ex-situ conservation is undertaken.
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Define – Incomplete dominance.
Chapter: [3] Inheritance and Variation
If a red flowered Mirabilis jalapa plant is crossed with a white flowered plant, what will be the phenotypic ratio in F2 generation? Show it by a chart.
Chapter: [3] Inheritance and Variation
Differentiate between sympathetic and parasympathetic nervous system with reference to the following:
- Pre and post-ganglionic nerve fibres
- Effect on heartbeat
Chapter: [9] Control and Co-ordination
Give reason – All spinal nerves are of mixed type.
Chapter: [9] Control and Co-ordination
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
Chapter: [4] Molecular Basis of Inheritance
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Chapter: [4] Molecular Basis of Inheritance
Describe the steps in breathing.
Chapter: [8] Respiration and Circulation
What is spermatogenesis?
Chapter: [2] Reproduction in Lower and Higher Animals
Draw a neat and labelled diagram of spermatogenesis.
Chapter: [2] Reproduction in Lower and Higher Animals
What is a connecting link?
Chapter: [5] Origin and Evolution of Life
Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.
Chapter: [5] Origin and Evolution of Life
Advertisements
Complete the following chart regarding population interaction and re-write:
| Sr. No. | Name of interaction | Interaction between |
| 1. | ? | Plasmodium and Man |
| 2. | ? | Leopard and Lion |
| 3. | ? | Clownfish and Sea-anemone |
Chapter: [13] Organisms and Populations
What is the composition of biogas?
Chapter: [11] Enhancement of Food Production
Mention any four benefits of biogas.
Chapter: [11] Enhancement of Food Production
Give reason – Water acts as thermal buffer
Chapter: [6] Plant Water Relation
Draw a neat and proportionate diagram of root hair and label mitochondria, nucleus and vacuole.
Chapter:
Explain three main functions of free antibodies produced by B-lymphocytes.
Chapter:
Following are the diagrams of entry of pollen tube into ovule. Identify the type A and B.

Chapter: [1] Reproduction in Lower and Higher Plants
Give any four points of significance of double fertilization.
Chapter:
Name the hormone that is responsible for apical dominance.
Chapter: [7] Plant Growth and Mineral Nutrition
A farmer wants to remove broad-leaved weeds from the jowar plantation in his field. Suggest any plant hormone to remove such weeds.
Chapter: [7] Plant Growth and Mineral Nutrition
Mention any two applications of cytokinin.
Chapter: [7] Plant Growth and Mineral Nutrition
What is blood pressure?
Chapter: [8] Respiration and Circulation
Give the name of the instrument which is used to measure the blood pressure.
Chapter: [8] Respiration and Circulation
Differentiate between an artery and a vein with reference to lumen and thickness of wall.
Chapter: [8] Respiration and Circulation
Describe any three adaptations in anemophilous flowers.
Chapter: [1] Reproduction in Lower and Higher Plants
Mention any one example of the anemophilous flower.
Chapter: [1] Reproduction in Lower and Higher Plants
Describe any three adaptations in hydrophilous flowers.
Chapter: [1] Reproduction in Lower and Higher Plants
Mention any one example of the hydrophilous flower.
Chapter: [1] Reproduction in Lower and Higher Plants
What is polymerase chain reaction (PCR)?
Chapter: [12] Biotechnology
Describe three steps involved in mechanism of PCR.
Chapter: [12] Biotechnology
Give any four significances of fertilization in humans.
Chapter: [2] Reproduction in Lower and Higher Animals
Mention the names of any two organs each derived from ectoderm and mesoderm.
Chapter: [2] Reproduction in Lower and Higher Animals
Write the names of any four motor cranial nerves with their appropriate serial number.
Chapter: [9] Control and Co-ordination
Which hormones stimulate liver for glycogenesis and glycogenolysis?
Chapter: [9] Control and Co-ordination
Other Solutions
Submit Question Paper
Help us maintain new question papers on Shaalaa.com, so we can continue to help studentsonly jpg, png and pdf files
Maharashtra State Board previous year question papers 12th Standard Board Exam Biology with solutions 2022 - 2023
Previous year Question paper for Maharashtra State Board 12th Standard Board Exam Biology-2023 is solved by experts. Solved question papers gives you the chance to check yourself after your mock test.
By referring the question paper Solutions for Biology, you can scale your preparation level and work on your weak areas. It will also help the candidates in developing the time-management skills. Practice makes perfect, and there is no better way to practice than to attempt previous year question paper solutions of Maharashtra State Board 12th Standard Board Exam.
How Maharashtra State Board 12th Standard Board Exam Question Paper solutions Help Students ?
• Question paper solutions for Biology will helps students to prepare for exam.
• Question paper with answer will boost students confidence in exam time and also give you an idea About the important questions and topics to be prepared for the board exam.
• For finding solution of question papers no need to refer so multiple sources like textbook or guides.
