मराठी

Science (English Medium) इयत्ता १२ - CBSE Important Questions

Advertisements
विषय
अध्याय
विषय
मुख्य विषय
अध्याय

Please select a subject first

Advertisements
Advertisements
< prev  341 to 360 of 4827  next > 

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Genetic Code

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Enlist any four prime goals of HGP.

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Human Genome Project

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Name any one common non-human animal model organism which has also been sequenced thereafter.

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Human Genome Project

What does the following equation represent? Explain:

p2 + 2pq + q2 = 1.

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Hardy Weinberg’s Principle

Mention the evolutionary significance of the Shrews

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Evolution of Life Forms - a Theory

Mention the evolutionary significance of the Lobefins

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Evolution of Life Forms - a Theory

Mention the evolutionary significance of the Homo habilis

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Evolution of Life Forms - a Theory

p2 + 2pq + q2 = 1. Explain this algebraic equation on the basis of Hardy Weinberg's principle.

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Hardy Weinberg’s Principle

A heavily bleeding and bruised road accident victim was brought to a nursing home. The doctor immediately gave him an injection to protect him against a deadly disease.

  1. Write what did the doctor inject into the patient’s body.
  2. How do you think this injection would protect the patient against the disease?
  3. Name the disease against which this injection was given and the kind of immunity it provides.
Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Immunity

Name any two types of cells that act as ‘cellular barriers’ to provide innate immunity in humans.

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Immunity

Cancer is one of the most dreaded diseases. Explain 'Contact inhibition' and 'Metastasis' with respect to the disease

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Cancer

Name any two techniques that are useful in detecting cancers of internal organs.

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Cancer

Why are cancer patients often given α-interferon as part of the treatment?

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Cancer

Prior to a sports event, blood and urine samples of sports persons are collected for drug tests.

  1. Why is there a need to conduct such tests?
  2. Name the drugs the authorities usually look for.
  3. Write the generic names of two plants from which these drugs are obtained.
Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Drugs and Alcohol Abuse

A team of students are preparing to participate in the interschool sports meet. During a practice session you find some vials with labels of certain cannabinoids.

  1. Will you report to the authorities? Why?
  2. Name of a plant from which such chemicals are obtained.
  3. Write the effect of these chemicals on human body.
Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Drugs and Alcohol Abuse

Suggest a method to ensure an anamnestic response in humans.

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Immunity

Enumerate four most common warning signs of drug and alcohol abuse amongst the youth.

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Categories of Drugs >> Effects of Drug and Alcohol Abuse

A boy developed some allergic reactions when he straight entered into his air conditioned room after a game of football outside his house. Write any two symptoms that could be noticed in such condition. How does our body combat such conditions?

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Allergies

Epithelial lining of our intestine is considered as secondary lymphoid organ. Justify the statement.

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: The Immune System

State the medicinal value and the bioactive molecules produced by Streptococcus, Monascus and Trichoderma.

Appears in 3 question papers
Chapter: [8] Microbes in Human Welfare
Concept: Microbes as Biocontrol Agents
< prev  341 to 360 of 4827  next > 
Advertisements
Advertisements
CBSE Science (English Medium) इयत्ता १२ Important Questions
Important Questions for CBSE Science (English Medium) इयत्ता १२ Biology
Important Questions for CBSE Science (English Medium) इयत्ता १२ Chemistry
Important Questions for CBSE Science (English Medium) इयत्ता १२ Computer Science (C++)
Important Questions for CBSE Science (English Medium) इयत्ता १२ English Core
Important Questions for CBSE Science (English Medium) इयत्ता १२ English Elective - NCERT
Important Questions for CBSE Science (English Medium) इयत्ता १२ Entrepreneurship
Important Questions for CBSE Science (English Medium) इयत्ता १२ Hindi (Core)
Important Questions for CBSE Science (English Medium) इयत्ता १२ Hindi (Elective)
Important Questions for CBSE Science (English Medium) इयत्ता १२ History
Important Questions for CBSE Science (English Medium) इयत्ता १२ Informatics Practices
Important Questions for CBSE Science (English Medium) इयत्ता १२ Mathematics
Important Questions for CBSE Science (English Medium) इयत्ता १२ Physical Education
Important Questions for CBSE Science (English Medium) इयत्ता १२ Physics
Important Questions for CBSE Science (English Medium) इयत्ता १२ Political Science
Important Questions for CBSE Science (English Medium) इयत्ता १२ Psychology
Important Questions for CBSE Science (English Medium) इयत्ता १२ Sociology
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×