Science (English Medium) कक्षा १२ - CBSE Important Questions

Explain the process of making heterogeneous nuclear RNA (hnRNA) into a fully functional mRNA in eukaryotes. Where does this process occur in the cell?

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Enlist any four prime goals of HGP.

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Name any one common non-human animal model organism which has also been sequenced thereafter.

What does the following equation represent? Explain:

p² + 2pq + q² = 1.

Mention the evolutionary significance of the Shrews

Mention the evolutionary significance of the Lobefins

Mention the evolutionary significance of the Homo habilis

p² + 2pq + q² = 1. Explain this algebraic equation on the basis of Hardy Weinberg's principle.

A heavily bleeding and bruised road accident victim was brought to a nursing home. The doctor immediately gave him an injection to protect him against a deadly disease.

1. Write what did the doctor inject into the patient’s body.
2. How do you think this injection would protect the patient against the disease?
3. Name the disease against which this injection was given and the kind of immunity it provides.

Name any two types of cells that act as ‘cellular barriers’ to provide innate immunity in humans.

Cancer is one of the most dreaded diseases. Explain 'Contact inhibition' and 'Metastasis' with respect to the disease

Name any two techniques that are useful in detecting cancers of internal organs.

Why are cancer patients often given α-interferon as part of the treatment?

Prior to a sports event, blood and urine samples of sports persons are collected for drug tests.

1. Why is there a need to conduct such tests?
2. Name the drugs the authorities usually look for.
3. Write the generic names of two plants from which these drugs are obtained.

A team of students are preparing to participate in the interschool sports meet. During a practice session you find some vials with labels of certain cannabinoids.

1. Will you report to the authorities? Why?
2. Name of a plant from which such chemicals are obtained.
3. Write the effect of these chemicals on human body.

Suggest a method to ensure an anamnestic response in humans.

Enumerate four most common warning signs of drug and alcohol abuse amongst the youth.

A boy developed some allergic reactions when he straight entered into his air conditioned room after a game of football outside his house. Write any two symptoms that could be noticed in such condition. How does our body combat such conditions?

Epithelial lining of our intestine is considered as secondary lymphoid organ. Justify the statement.