HSC Science (General) 12th Standard Board Exam - Maharashtra State Board Important Questions for Biology

Distinguish between heterochromatin and euchromatin with reference to staining property and activity.

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

Give the different steps involved in formation of m-RNA from hn-RNA.

The number of purines in a segment of a DNA molecule is 68. What will be the number of pyrimidines in this segment?

Give the floral adaptations for chiropterophily.

Struggle between cow and cow to get grass is called ______.

In which type of adaptation, forelimbs are modified into wings?

(a) Aquatic adaptations

(b) Volant adaptations

(c) Arboreal adaptations

(d) Cursorial adaptations

The connecting link between ‘ape’ and ‘man’ is _______.

(A) Dryopithecus

(B) Australopithecus

(C) Homo erectus

(D) Homo neanderthalensis

Explain the concept ‘survival of the fittest’.

Enlist any 'two' floral adaptations in salvia.

Give the principles of Darwin's theory of natural selection.

Overproduction is the principle of

(A) Lamarckism

(B) Theory of organic evolution

(C) Panspermia theory

(D) Modern theory of evolution

Why only left ovary and oviduct arc present in birds?

Give the graphical representation of Hardy· Weinberg's principle in the form of Punnet Square.

Transfer of gene between the population that differ genetically from one another is called _____.

(A) Gene mutation

(B) Gene flow

(C) Genetic drift

(D) Genetic recombination

Longer toes and long prehensile tail indicate which adaptation?

All organisms produce more young ones. Comment

Define ‘reproductive isolation’ and explain two types of reproductive isolation.

Answer the following question in ‘One’ sentence only:

Define ‘mutation breeding’.