HSC Science (General) इयत्ता १२ वी - Maharashtra State Board Important Questions for Biology

What happened when heat-killed S-cells along with living R-cells were injected into mice?

Semiconservative mechanism of DNA was detected using:

What is the role of Mg⁺⁺ in Translation?

Enlist the names of enzymes used in semiconservative replication of DNA?

Differentiate between Heterochromatin & Euchromatin.

Draw a neat and labelled diagram of the Nucleosome.

Draw neat and labelled diagram of Replication Fork.

Draw a neat and labelled diagram of transcription and processing of hn-RNA

How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?

Histones are rich in ______.

During the replication of DNA, the separated strands are prevented from recoiling by using ______.

Write the aims of the human genome project.

The nucleic acid synthesis takes place in ______.

Describe the process of transcription.

Distinguish between heterochromatin and euchromatin with reference to staining property and activity.

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

Give the different steps involved in formation of m-RNA from hn-RNA.

What is dark reaction in photosynthesis?

Describe C₃ Pathway.