Advertisements
Advertisements
प्रश्न
What is the correct sequence of the stages in bacteriophage lytic cycle?
(A) Attachment, Penetration, Lysis, Multiplication
(B) Attachment, Penetration, Multiplication, Lysis
(C) Lysis, Penetration, Multiplication, Attachment
(D) Attachment, Lysis, Multiplication, Penetration
Advertisements
उत्तर
(B) Attachment, Penetration, Multiplication, Lysis
APPEARS IN
संबंधित प्रश्न
______ enzymes are used as biological scissors in r-DNA technology.
Which enzyme does remove supercoils from replicating DNA?
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts
c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
In which direction polymerization of DNA nucleotides occurs during the synthesis of lagging strand?
______ carbon atoms of successive nucleotides of nucleic acid are linked by Phospho-diester bond.
In a segment of DNA with 10 base pairs, the numbers of sugar molecules are _________.
When the DNA molecule appears like inverted Y, it is ______
In viral DNA, how many origins of replication is/are present?
Characteristics unique to DNA are ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
