Advertisements
Advertisements
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts

c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
Concept: undefined >> undefined
GEAC stands for ______.
Concept: undefined >> undefined
Advertisements
Animals that can move from fresh water to sea called as ________.
Concept: undefined >> undefined
Klinefelters’ syndrome is characterized by a karyotype of ____________.
Concept: undefined >> undefined
Females with Turners’ syndrome have
Concept: undefined >> undefined
Pataus’ syndrome is also referred to as ____________.
Concept: undefined >> undefined
Mention the symptoms of Down syndrome.
Concept: undefined >> undefined
A mRNA molecule is produced by ____________.
Concept: undefined >> undefined
Which of the following is the correct sequence of event with reference to the central dogma?
Concept: undefined >> undefined
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

Concept: undefined >> undefined
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Concept: undefined >> undefined
How is the two stage process of protein synthesis advantageous?
Concept: undefined >> undefined
Define isolating mechanism and explain its types with suitable examples.
Concept: undefined >> undefined
Describe Population Age Distribution.
Concept: undefined >> undefined
The use of microorganism metabolism to remove pollutants such as oil spills in the water bodies is known as ____________.
Concept: undefined >> undefined
In the E-waste generated by the Mobile Phones, which among the following metal is most abundant?
Concept: undefined >> undefined
Discuss the role of an individual to reduce environmental pollution.
Concept: undefined >> undefined
How does recycling help reduce pollution?
Concept: undefined >> undefined
What is extra chromosomal inheritance?
Concept: undefined >> undefined
The first codon to be deciphered was __________ which codes for ________.
Concept: undefined >> undefined
