HSC Science इयत्ता १२ - Tamil Nadu Board of Secondary Education Question Bank Solutions for Zoology

a) Identify the figure given below

b) Redraw the structure as a replicating fork and label the parts

c) Write the source of energy for this replication and name the enzyme involved in this process.

d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.

GEAC stands for ______.

Animals that can move from fresh water to sea called as ________.

Klinefelters’ syndrome is characterized by a karyotype of ____________.

Females with Turners’ syndrome have

Pataus’ syndrome is also referred to as ____________.

Mention the symptoms of Down syndrome.

A mRNA molecule is produced by ____________.

Which of the following is the correct sequence of event with reference to the central dogma?

Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'

Write down the sequence of mRNA.

How is the two stage process of protein synthesis advantageous?

Define isolating mechanism and explain its types with suitable examples.

Describe Population Age Distribution.

The use of microorganism metabolism to remove pollutants such as oil spills in the water bodies is known as ____________.

In the E-waste generated by the Mobile Phones, which among the following metal is most abundant?

Discuss the role of an individual to reduce environmental pollution.

How does recycling help reduce pollution?

What is extra chromosomal inheritance?

The first codon to be deciphered was __________ which codes for ________.