Advertisements
Advertisements
प्रश्न
Which enzyme does remove supercoils from replicating DNA?
Advertisements
उत्तर
Super-helix relaxing enzyme (Topoisomerase) removes supercoils from replicating DNA.
APPEARS IN
संबंधित प्रश्न
Define Heterochromatin.
E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?
Which of the following statements is not true about DNA replication in eukaryotes?
Read the following statements and select the correct option.
i. The unit of DNA in which replication occurs, is called replicon.
ii. In eukaryotes, there is only one replicon however in prokaryotes there are several replicons in tandem.
During DNA replication, Okazaki fragments are used to elongate ____________.
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
Which of the following is the function of single-strand binding proteins?
Read the following statements and select the correct option.
Statement I: DNA replication is continuous on leading strand while on the lagging strand it is discontinuous.
Statement II: DNA polymerase cannot initialize polymerization without a primer.
Which one of the following can form a nucleotide of DNA?
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
