HSC Science (General) इयत्ता १२ वी - Maharashtra State Board Question Bank Solutions for Biology

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

What is a connecting link?

Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.

Complete the following chart regarding population interaction and re-write:

Write a note on parasitism.

The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?

Define outcrossing

Name any two disorders of respiratory system.

What are the special adaptations that endoparasites show?

Enzyme involved in synthesis of RNA primer.

Select the statement which best describes parasitism.

In which interaction of species, both the species are at a loss?

Adsorption of water by hydrophilic colloids is called______.

What were the control measures taken by Delhi Government for combating air pollution?

Why do the wooden doors become very hard to close and open in rainy season?

Describe mutualism. 

What is differentiation?

What is redifferentiation?

Select and rewrite the appropriate disorder of the respiratory system with the given symptom.

Breakdown of alveoli, shortness of breath.

Select and rewrite the appropriate disorder of the respiratory system with the given symptom.

Inflammation of the sinuses, mucous discharge.