हिंदी

HSC Science (General) १२ वीं कक्षा - Maharashtra State Board Question Bank Solutions

Advertisements
विषयों
अध्याय
विषयों
मुख्य विषय
अध्याय

Please select a subject first

Advertisements
Advertisements
< prev  381 to 400 of 12688  next > 

The nucleic acid synthesis takes place in ______.

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

The species placed in CR category is ______.

[15] Biodiversity, Conservation and Environmental Issues
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Concept: undefined >> undefined

Advertisements

Draw a diagram of pyramid of energy.

[14] Ecosystems and Energy Flow
Chapter: [14] Ecosystems and Energy Flow
Concept: undefined >> undefined

Explain how imbibition helps root hairs in adsorption of water.

[6] Plant Water Relation
Chapter: [6] Plant Water Relation
Concept: undefined >> undefined

What is ex-situ conservation?

[15] Biodiversity, Conservation and Environmental Issues
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Concept: undefined >> undefined

Mention any two places where the ex-situ conservation is undertaken.

[15] Biodiversity, Conservation and Environmental Issues
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Concept: undefined >> undefined

Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

What is a connecting link?

[5] Origin and Evolution of Life
Chapter: [5] Origin and Evolution of Life
Concept: undefined >> undefined

Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.

[5] Origin and Evolution of Life
Chapter: [5] Origin and Evolution of Life
Concept: undefined >> undefined

The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

The electronegativity inside the membrane is due to

[9] Control and Co-ordination
Chapter: [9] Control and Co-ordination
Concept: undefined >> undefined

Give definitions of Extinct species.

[15] Biodiversity, Conservation and Environmental Issues
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Concept: undefined >> undefined

Give definitions of Endangered species.

[15] Biodiversity, Conservation and Environmental Issues
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Concept: undefined >> undefined

Give definitions of Invasive species.

[15] Biodiversity, Conservation and Environmental Issues
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Concept: undefined >> undefined

Write any three criteria on which different types of reflexes are based.

[15] Biodiversity, Conservation and Environmental Issues
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Concept: undefined >> undefined

Explain lag phase, log phase and steady phase of growth.

[7] Plant Growth and Mineral Nutrition
Chapter: [7] Plant Growth and Mineral Nutrition
Concept: undefined >> undefined

What are the reasons for loss of biodiversity?

[15] Biodiversity, Conservation and Environmental Issues
Chapter: [15] Biodiversity, Conservation and Environmental Issues
Concept: undefined >> undefined

Enzyme involved in synthesis of RNA primer.

[4] Molecular Basis of Inheritance
Chapter: [4] Molecular Basis of Inheritance
Concept: undefined >> undefined

Adsorption of water by hydrophilic colloids is called______.

[6] Plant Water Relation
Chapter: [6] Plant Water Relation
Concept: undefined >> undefined
< prev  381 to 400 of 12688  next > 
Advertisements
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×