Please select a subject first
Advertisements
Advertisements
The nucleic acid synthesis takes place in ______.
Concept: undefined >> undefined
The species placed in CR category is ______.
Concept: undefined >> undefined
Advertisements
Draw a diagram of pyramid of energy.
Concept: undefined >> undefined
Explain how imbibition helps root hairs in adsorption of water.
Concept: undefined >> undefined
What is ex-situ conservation?
Concept: undefined >> undefined
Mention any two places where the ex-situ conservation is undertaken.
Concept: undefined >> undefined
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
Concept: undefined >> undefined
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Concept: undefined >> undefined
What is a connecting link?
Concept: undefined >> undefined
Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.
Concept: undefined >> undefined
The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?
Concept: undefined >> undefined
The electronegativity inside the membrane is due to
Concept: undefined >> undefined
Give definitions of Extinct species.
Concept: undefined >> undefined
Give definitions of Endangered species.
Concept: undefined >> undefined
Give definitions of Invasive species.
Concept: undefined >> undefined
Write any three criteria on which different types of reflexes are based.
Concept: undefined >> undefined
Explain lag phase, log phase and steady phase of growth.
Concept: undefined >> undefined
What are the reasons for loss of biodiversity?
Concept: undefined >> undefined
Enzyme involved in synthesis of RNA primer.
Concept: undefined >> undefined
Adsorption of water by hydrophilic colloids is called______.
Concept: undefined >> undefined
