हिंदी

Science (English Medium) कक्षा १२ - CBSE Important Questions for Biology

Advertisements
[object Object]
[object Object]
विषयों
मुख्य विषय
अध्याय
Advertisements
Advertisements
Biology
< prev  61 to 80 of 569  next > 

Public all over India is very much concerned about the deteriorating air quality in large parts of North India. Alarmed by this situation the Resident’s Welfare Association of your locality organized an awareness programme entitled “Bury not burn”. They invited you, being a biology student to participate.

  1. How would you justify your arguments that promote burying and discourage burning? (Give two reasons)
  2. With the help of flow charts, one for each practice depict the chain of events that follow.
Appears in 3 question papers
Chapter: [4] Environmental Issues
Concept: Effects of Domestic Sewage and Industrial Effluents on Water

The chromosome number is fixed for all normal organisms leading to species specification whereas any abnormality in the chromosome number of an organism results into abnormal individuals. For example, in humans, 46 is the fixed number of chromosomes both male and female. In males it is '44 + XY' and in females, it is '44 +XX'. Thus the human male is heterogametic, in other words produces two different types of gametes one with '22 + X' chromosomes and the other with '22 + Y' chromosomes respectively. Human female, on the other hand, is homo gametic i.e. produce only one type of gamete with '22 + X' chromosomes only.

Sometimes an error may occur during the meiosis of the cell cycle, where the sister chromatids fail to segregate called nondisjunction, leading to the production of abnormal gametes with altered chromosome numbers. On fertilisation, such gametes develop into abnormal individuals.

(a) State what is aneuploidy. (1)

(b) If during spermatogenesis, the chromatids of sex chromosomes fail to segregate during meiosis, write only the different types of gametes with altered chromosome numbers that could possibly be produced. (1)

(c) A normal human sperm (22 + Y) fertilises an ovum with karyotype '22 +XX'. Name the disorder the offspring thus produced would suffer from and write any two symptoms of the disorder. (2)

OR

(c) Name the best-known and most common autosomal aneuploid abnormality in humans and write any two symptoms. (2)

Appears in 3 question papers
Chapter: [4] Principles of Inheritance and Variation
Concept: Human Genetic Disorders >> Chromosomal Disorders or Abnormalities

What is a cistron?

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Protein Synthesis >> Transcription Unit and the Gene

(i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Protein Synthesis >> Transcription

Name the transcriptionally active region of chromatin in a nucleus.

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Packaging of DNA Helix

Explain the process of making heterogeneous nuclear RNA (hnRNA) into a fully functional mRNA in eukaryotes. Where does this process occur in the cell?

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Protein Synthesis >> Process of Transcription in Bacteria

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Genetic Code

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Enlist any four prime goals of HGP.

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Human Genome Project

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Name any one common non-human animal model organism which has also been sequenced thereafter.

Appears in 3 question papers
Chapter: [5] Molecular Basis of Inheritance
Concept: Human Genome Project

What does the following equation represent? Explain:

p2 + 2pq + q2 = 1.

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Hardy Weinberg’s Principle

Mention the evolutionary significance of the Shrews

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Evolution of Life Forms - a Theory

Mention the evolutionary significance of the Lobefins

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Evolution of Life Forms - a Theory

Mention the evolutionary significance of the Homo habilis

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Evolution of Life Forms - a Theory

p2 + 2pq + q2 = 1. Explain this algebraic equation on the basis of Hardy Weinberg's principle.

Appears in 3 question papers
Chapter: [6] Evolution
Concept: Hardy Weinberg’s Principle

A heavily bleeding and bruised road accident victim was brought to a nursing home. The doctor immediately gave him an injection to protect him against a deadly disease.

  1. Write what did the doctor inject into the patient’s body.
  2. How do you think this injection would protect the patient against the disease?
  3. Name the disease against which this injection was given and the kind of immunity it provides.
Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Immunity

Name any two types of cells that act as ‘cellular barriers’ to provide innate immunity in humans.

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Immunity

Cancer is one of the most dreaded diseases. Explain 'Contact inhibition' and 'Metastasis' with respect to the disease

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Cancer

Name any two techniques that are useful in detecting cancers of internal organs.

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Cancer

Why are cancer patients often given α-interferon as part of the treatment?

Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Cancer

Prior to a sports event blood & urine samples of sports persons are collected for drug tests.

  1. Why is there a need to conduct such tests?
  2. Name the drugs the authorities usually look for.
  3. Write the generic names of two plants from which these drugs are obtained.
Appears in 3 question papers
Chapter: [7] Human Health and Diseases
Concept: Types and Effects of Psychoactive Drugs >> Drugs and Alcohol Abuse
< prev  61 to 80 of 569  next > 
Advertisements
Advertisements
CBSE Science (English Medium) कक्षा १२ Important Questions
Important Questions for CBSE Science (English Medium) कक्षा १२ Biology
Important Questions for CBSE Science (English Medium) कक्षा १२ Chemistry
Important Questions for CBSE Science (English Medium) कक्षा १२ Computer Science (C++)
Important Questions for CBSE Science (English Medium) कक्षा १२ Computer Science (Python)
Important Questions for CBSE Science (English Medium) कक्षा १२ English Core
Important Questions for CBSE Science (English Medium) कक्षा १२ English Elective - NCERT
Important Questions for CBSE Science (English Medium) कक्षा १२ Entrepreneurship
Important Questions for CBSE Science (English Medium) कक्षा १२ Geography
Important Questions for CBSE Science (English Medium) कक्षा १२ Hindi (Core)
Important Questions for CBSE Science (English Medium) कक्षा १२ Hindi (Elective)
Important Questions for CBSE Science (English Medium) कक्षा १२ History
Important Questions for CBSE Science (English Medium) कक्षा १२ Informatics Practices
Important Questions for CBSE Science (English Medium) कक्षा १२ Mathematics
Important Questions for CBSE Science (English Medium) कक्षा १२ Physical Education
Important Questions for CBSE Science (English Medium) कक्षा १२ Physics
Important Questions for CBSE Science (English Medium) कक्षा १२ Political Science
Important Questions for CBSE Science (English Medium) कक्षा १२ Psychology
Important Questions for CBSE Science (English Medium) कक्षा १२ Sanskrit (Core)
Important Questions for CBSE Science (English Medium) कक्षा १२ Sociology
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×