Advertisements
Advertisements
Mark the odd one.
Concept: undefined >> undefined
The coconut water from tender coconut is ______
Concept: undefined >> undefined
Advertisements
Which of the following statements are true related to Seed X and Y?
 |
 |
| SEED X | SEED Y |
- Seed X is dicot and endospermic or albuminous.
- Seed X is dicot and non-endospermic or non-albuminous.
- Seed Y is a monocot and endospermic or albuminous.
- Seed Y is a monocot and non-endospermic or non-albuminous.
Choose the correct option with the respect to the nature of the seed.
Concept: undefined >> undefined
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Concept: undefined >> undefined
Why does the zygote begin to divide only after the division of Primary endosperm cell (PEC)?
Concept: undefined >> undefined
What is Down’s syndrome? Give its symptoms and cause. Why is it that the chances of having a child with Down’s syndrome increases if the age of the mother exceeds forty years?
Concept: undefined >> undefined
How was it concluded that genes are located on chromosomes?
Concept: undefined >> undefined
Define aneuploidy. How is it different from polyploidy? Describe the individuals having following chromosomal abnormalities.
- Trisomy of 21st Chromosome
- XXY
- XO
Concept: undefined >> undefined
Which of the following statements is the most appropriate for sickle cell anaemia?
Concept: undefined >> undefined
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Concept: undefined >> undefined
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Concept: undefined >> undefined
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Concept: undefined >> undefined
Discuss the process of translation in detail.
Concept: undefined >> undefined
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Concept: undefined >> undefined
|
The chromosome number is fixed for all normal organisms leading to species specification whereas any abnormality in the chromosome number of an organism results into abnormal individuals. For example, in humans, 46 is the fixed number of chromosomes both male and female. In males it is '44 + XY' and in females, it is '44 +XX'. Thus the human male is heterogametic, in other words produces two different types of gametes one with '22 + X' chromosomes and the other with '22 + Y' chromosomes respectively. Human female, on the other hand, is homo gametic i.e. produce only one type of gamete with '22 + X' chromosomes only. Sometimes an error may occur during the meiosis of the cell cycle, where the sister chromatids fail to segregate called nondisjunction, leading to the production of abnormal gametes with altered chromosome numbers. On fertilisation, such gametes develop into abnormal individuals. |
(a) State what is aneuploidy. (1)
(b) If during spermatogenesis, the chromatids of sex chromosomes fail to segregate during meiosis, write only the different types of gametes with altered chromosome numbers that could possibly be produced. (1)
(c) A normal human sperm (22 + Y) fertilises an ovum with karyotype '22 +XX'. Name the disorder the offspring thus produced would suffer from and write any two symptoms of the disorder. (2)
OR
(c) Name the best-known and most common autosomal aneuploid abnormality in humans and write any two symptoms. (2)
Concept: undefined >> undefined
How does smoking tobacco in human lead to oxygen deficiency in their body?
Concept: undefined >> undefined
Prior to a sports event, blood and urine samples of sports persons are collected for drug tests.
- Why is there a need to conduct such tests?
- Name the drugs the authorities usually look for.
- Write the generic names of two plants from which these drugs are obtained.
Concept: undefined >> undefined
A team of students are preparing to participate in the interschool sports meet. During a practice session you find some vials with labels of certain cannabinoids.
- Will you report to the authorities? Why?
- Name of a plant from which such chemicals are obtained.
- Write the effect of these chemicals on human body.
Concept: undefined >> undefined
A group of youth were having a ‘rave party’ in an isolated area and was raided by police. Packets of ‘smack’ and syringes with needles were found littered around.
- Why is taking ‘smack’ considered an abuse?
- Write the chemical name of ‘smack’ and the name of its source plant.
- Syringes and needles used by the youth for taking the drug could prove to be very fatal. Why?
Concept: undefined >> undefined
You have attended a birthday party hosted by one of your classmates. You found some guests at the party sitting in a corner making a lot of noise and consuming 'something'. After a while one of the boys from the group started screaming, behaving abnormally and sweating profusely. On enquiry you found that the group members were taking drugs.
(a) Would you inform your parents/school authorities ? Yes/No. Give reasons in support of your answer.
(b) Prepare a note to be circulated amongst the schoolmates about the sources and dangers of any two drugs.
(c) Write any two ways that you will suggest to your school principal so as to promote awareness amongst the youth against the use of these drugs.
Concept: undefined >> undefined
