हिंदी

Biology Board Sample Paper 2025-2026 Science (English Medium) Class 12 Question Paper Solution

Advertisements
Biology [Board Sample Paper]
Marks: 70 CBSE
Science (English Medium)

Academic Year: 2025-2026
Date: मार्च 2026
Advertisements

General Instructions:

  1. All questions are compulsory.
  2. The question paper has five sections and 33 questions.
  3. Section - A has 16 questions of 1 mark each; Section - B has 5 questions of 2 marks each; Section - C has 7 questions of 3 marks each; Section - D has 2 case-based questions of 4 marks each; and Section - E has 3 questions of 5 marks each.
  4. There is no overall choice. Answer all 33 questions. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions.
  5. Wherever necessary, neat and properly labeled diagrams should be drawn.

Section – A
[1]1 | Q. No. 1 to 12 are multiple choice questions. Only one of the choices is correct. Select and write the correct choice as well as the answer to these questions.

The male gametes in plants are formed by ______.

Mitotic division of nucleus of vegetative cell

Meiotic division of nucleus of vegetative cell

Mitotic division of nucleus of generative cell

Meiotic division of nucleus of generative cell

Concept: undefined - undefined
Chapter:
[1]2

The primary endosperm nucleus is formed by fusion of which of the following?

A male gamete and a female gamete.

A male gamete and two polar nuclei.

A female gamete and two synergids.

Two male gametes and an egg cell.

Concept: undefined - undefined
Chapter:
[1]3

During the menstrual cycle of a human female, formation of graafian follicle is stimulated by secretion of which of the following gonadotropin hormones?

Estrogen and progesterone

FSH and Estrogen

FSH and LH

Progesterone and LH

Concept: undefined - undefined
Chapter:
[1]4

The experimental proof on the thermal stability of genetic material was first provided by experiments of ______.

Hershey and Chase

Meselson and Stahl

Frederick Griffith

Jacob an Monod

Concept: undefined - undefined
Chapter:
[1]5

Short stretches of DNA used to identify complementary sequences in a sample are called ______.

Probes

Markers

Primers

Minisatellites

Concept: undefined - undefined
Chapter:
[1]6

Select the incorrect statement among the following.

p2 + 2pq + q2 = 1. This is the binomial expansion of (p + q)2.

When frequency measured differs from the expected values, the difference (direction) indicates the extent of evolutionary change.

Hardy-Weinberg principle says that phenotype frequencies in a population are stable and are constant from generation to generation.

The gene pool (total genes and their alleles in a population) remains constant. This is called genetic equilibrium. Sum total of all the allelic frequencies is 1.

Concept: undefined - undefined
Chapter:
[1]7

Albinism is known to be due to an autosomal recessive mutation. The first child of a couple with normal skin pigmentation was an albino. What is the probability that their second child will also be an albino?

100%

25%

50%

75%

Concept: undefined - undefined
Chapter: [4] Principles of Inheritance and Variation
[1]8

“In Cricket species, the sound produced by rubbing the wings or legs together plays a crucial role in attracting mates; any change in the morphology of Cricket legs could potentially affect their ability to produce sound.”

A mutant Cricket had thicker hind legs. What would you expect for this cricket species?

The leg mutation will not lead to speciation if they diversify into new habitats.

The leg mutation will have little effect on other external features and therefore have little effect on speciation.

The leg mutation will have no effect on behavior and thus have little effect on speciation.

The leg mutation might lead to reproductive isolation and speciation due to an effect on the mating call.

Concept: undefined - undefined
Chapter:
[1]9

Plasmodium is a pathogen that causes malaria. Identify the correct sequence of transmission of the pathogen.

I II III IV
Stage of pathogen as it is transferred by vector bite. First site in the host body where the pathogens infect and proliferate. Second site in the host body where the pathogen infects and manifests clinical symptoms. Stage of the pathogen as it is transferred to a new vector.
Sporozoites Erythrocyte infection Liver infection Gametocytes
I II III IV
Stage of pathogen as it is transferred by vector bite. First site in the host body where the pathogens infect and proliferate. Second site in the host body where the pathogen infects and manifests clinical symptoms. Stage of the pathogen as it is transferred to a new vector.
Gametocytes Erythrocyte infection Liver infection Sporozoites
I II III IV
Stage of pathogen as it is transferred by vector bite. First site in the host body where the pathogens infect and proliferate. Second site in the host body where the pathogen infects and manifests clinical symptoms. Stage of the pathogen as it is transferred to a new vector.
Gametocytes Liver infection Erythrocyte infection Sporozoites
I II III IV
Stage of pathogen as it is transferred by vector bite. First site in the host body where the pathogens infect and proliferate. Second site in the host body where the pathogen infects and manifests clinical symptoms. Stage of the pathogen as it is transferred to a new vector.
Sporozoites Liver infection Erythrocyte infection Gametocytes
Concept: undefined - undefined
Chapter:
[1]10

Which mRNA will be translated to a polypeptide chain containing 8 amino acids?

AUGUUAAUAGACGAGUAGCGACGAUGU

AUGAGACGGACUGCAUUCCCAACCUGA

AUGCCCAACCGUUAUUCAUGCUAG

AUGUCGACAGUCUAAAACAGCGGG

Concept: undefined - undefined
Chapter:
[1]11

In order to isolate genetic material of a bacterium, the cell must be treated with ______.

Lysozyme, ribonuclease, protease, chilled ethanol

Cellulase, ribonuclease, protease, chilled ethanol

Chitinase, ribonuclease, chilled ethanol, water

Ribonuclease, protease, chilled ethanol, water

Concept: undefined - undefined
Chapter:
[1]12

Integrated Pest Management involves:

  1. Using pesticides/insecticides judiciously
  2. Using biocontrol agents
  3. Engaging in organic farming

Only I

Only II

Both I and II

Only III

Concept: undefined - undefined
Chapter:
[1]13 | Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer these questions selecting the appropriate option given below:

Assertion (A): The ability of the pistil to recognise the pollen is the result of a continuous dialogue between pollen and pistil.

Reason (R): This electrical dialogue allows only compatible pollen to germinate.

Both A and R are true and R is the correct explanation of A.

Both A and R are true and R is not the correct explanation of A.

A is true but R is false.

A is false but R is true.

Concept: undefined - undefined
Chapter:
[1]14

Assertion (A): Some organisms are better adapted to survive in an otherwise hostile environment.

Reason (R): Adaptive ability is inherited and has a genetic basis.

Both A and R are true and R is the correct explanation of A.

Both A and R are true and R is not the correct explanation of A.

A is true but R is false.

A is false but R is true.

Concept: undefined - undefined
Chapter:
[1]15

Assertion (A): Excess dose of coke or crack produces a sense of euphoria, increased energy and causes hallucinations.

Reason (R): It interferes with the transport of dopamine.

Both A and R are true and R is the correct explanation of A.

Both A and R are true and R is not the correct explanation of A.

A is true but R is false.

A is false but R is true.

Concept: undefined - undefined
Chapter:
[1]16

Assertion (A): Rosie was the first transgenic cow to make more nutritionally balanced milk for consumption by human babies.

Reason (R): The milk of Rosie the cow contained human beta-lactalbumin, which made the milk rich in protein.

Both A and R are true and R is the correct explanation of A.

Both A and R are true and R is not the correct explanation of A.

A is true but R is false.

A is false but R is true.

Concept: undefined - undefined
Chapter:
SECTION - B
[2]17 | Attempt either option A or B.
[2]17.A

During artificial hybridization, it is important to ensure that only desired pollen grains are used for pollination. How is it ensured?

Concept: undefined - undefined
Chapter:
OR
[2]17.B

Why is manual transfer of desired pollen grains relatively easy in pea plants for hybridization, but in wheat, pollen grains are often utilized from pollen banks for hybridization purposes?

Concept: undefined - undefined
Chapter:
Advertisements
[2]18

How is the rate of initiation of RNA polymerase at a given promoter in a transcriptional unit of prokaryotes regulated?

Concept: undefined - undefined
Chapter:
[2]19

The table below shows a hypothetical blood report of a patient.

Test description Observed value Unit Reference range
Leucocytes      
Total leucocyte count 1100 Per Microliter 4400-11000
Neutrophils 31 % 55-70
Lymphocytes 25 % 20-40
Basophils 0.5 % 0.5-1
Eosinophils 02 % 1-4
Monocytes 0 % 1-8
  1. Looking at the values suggests which defense mechanism/immunity is affected and states how this defense mechanism provides immunity.
  2. Name the barrier with the least count and enumerate its role in providing immunity.
Concept: undefined - undefined
Chapter:
[2]20 | Attempt either option A or B.
[2]20.A

A cheese maker claims to be a biotechnologist. How will you support the same?

Concept: undefined - undefined
Chapter:
OR
[2]20.B

Why does the ‘insertional inactivation’ method to detect recombinant DNA is preferred to ‘antibiotic resistance’ procedure?

Concept: undefined - undefined
Chapter:
[2]21 | Attempt either option A or B.
[2]21.A

(i) Compare the two ecological pyramids of biomass I and II given below and explain the situations in which this is possible.

(ii) Construct an ideal pyramid of energy if 2,00,000 joules of sunlight are available.

Concept: undefined - undefined
Chapter:
OR
[2]21.B

A tropical rainforest in South America is home to more than 40,000 species of plants, 3,000 of fish, 1,300 of birds, 427 of mammals, 427 of amphibians, 378 of reptiles and 1,25,000 insects, snails and worms.

  1. From the given data, calculate the total number of known vertebrate species in the rainforest.
  2. Give a reason to justify the huge difference in the number of plant and animal species.
Concept: undefined - undefined
Chapter:
SECTION - C
[3]22
[1]22.A

Suggest a suitable contraceptive device for the following case with justification.

Mohini does not want to take the risk of conception and sexually transmitted infections (STIs).

Concept: undefined - undefined
Chapter:
[1]22.B

Suggest a suitable contraceptive device for the following case with justification.

Lalita has two children and does not want any more children.

Concept: undefined - undefined
Chapter:
[1]22.C

Suggest a suitable contraceptive device for the following case with justification.

Geeta wants a contraceptive that she can take until she wants to avoid conception and can resume back to her fertile life without the intervention of the doctor. Also, it should have a lower failure rate.

Concept: undefined - undefined
Chapter:
[3]23

Given below is a figure showing transport of ovum, fertilisation and passage of a growing embryo through the fallopian tube in a human female.

Answer the questions that follow:

  1. What will be the ploidy of cells shown in the (a) and (c) stages in the figure given below?
  2. What will happen if component L, as shown in the figure (g) given below, does not attach properly to the endometrium?
  3. In a pregnant mother (case X), during early pregnancy, the fertilised egg splits into two embryos at stage C shown in the figure given below, resulting in the formation of twins. Will the genome of cells of these two embryos exhibit variation? Justify your answer.

Concept: undefined - undefined
Chapter:
[3]24

In guinea pigs, black coat colour (G) dominates over white (g) and brown eyes (B) dominate over blue (b). The alleles for coat colour and eye colour are not linked. What will be the probability of the offspring having blue eyes and a white coat if both parents are heterozygous for eye and coat colour? Find the probability using a Punnett square.

Concept: undefined - undefined
Chapter:
[3]25

Shown below are certain aquatic vertebrates, where natural selection has favoured them to develop certain characteristics which enable them to live in water.

  1. Name and explain the phenomenon exhibited by the above animals.  (2)
  2. Which one of the above is the most primitive? What is its significance?  (1)
Concept: undefined - undefined
Chapter:
[3]26

The Biological Oxygen Demand (BOD) of a primary effluent during sewage treatment is reduced. Enlist the process of how this is achieved.

Concept: undefined - undefined
Chapter:
[3]27
[1]27.A

Expand ELISA.

Concept: undefined - undefined
Chapter:
[1]27.B

On what principle is the ELISA test based?

Concept: undefined - undefined
Chapter:
Advertisements
[1]27.C

List two ways by which an infection can be detected by an ELISA test.

Concept: undefined - undefined
Chapter:
[3]28

The population pyramids of Japan for the years 1950, 2007 and on the basis of the estimated value for 2050 have been shown below to answer the questions that follow:

  1. Comment upon the growth status of the population on the basis of the shape of the age pyramids.
  2. What insights can you gain about their population dynamics?
Concept: undefined - undefined
Chapter:
SECTION - D
[4]29

Given below is a set of information about some fruits and seeds.

Fruit Fruit and seed formation
P Nucellar cells surrounding the embryo sac develop into embryos.
Q Ovary develops into the fruit by the application of growth hormones.
R Thalamus contributes to fruit formation.
S Ovary matures into a fruit after fertilisation.

On the basis of the information provided above, answer the following questions with justification for each answer.

  1. How many embryo sacs will be present in each ovule of S before maturation and how many egg(s) will be present in each embryo sac when the embryo sac is developed from a single megaspore?    (1)
    1. Which of these fruits exhibits polyembryony? Will their embryos exhibit genetic variation? Justify.    (1)
    2. What will be ploidy of the embryonic cells in the above case?    (1)
  2. Which of these fruits can be considered as parthenocarpic? Give a reason.    (1)
    OR
  3. Which of the fruits P, Q, R or S is a true fruit with seeds? Give a reason.
Concept: undefined - undefined
Chapter:
[4]30

The graph below shows the Antibody concentration in young calves. Study the graph and answer the questions that follow:

  1. What do you think the difference is between passive and active immunity in this case?    (1)
  2. What kind of immunity will be observed when a vaccine is administered to the calf and why?    (2)
  3. What kind of trend does passive immunity show and why?    (1)
    OR
  4. Why does active immunity start after 14 days, as per the above graph?
Concept: undefined - undefined
Chapter:
SECTION - E
[5]31
[2]31.A

Construct a complete transcription unit with promoter and terminator on the basis of the hypothetical template strand given below.

Concept: undefined - undefined
Chapter:
[3]31.B

How is transcription a more complex process in eukaryotic cells? Explain the additional processes that a precursor mRNA has to undergo in these organisms.

Concept: undefined - undefined
Chapter:
[5]32
[5]32.A

Some plant and animal pathogens serve as one of the tools of recombinant DNA (rDNA) technology.

  1. Name one animal and one plant pathogen and discuss the pathogenic nature of both. State how they serve as a tool in rDNA technology.
  2. What are the enzymes needed for rDNA technology?
  3. A farmer owns a cotton farm land which is getting infested with coleopteran pests. He is not willing to use the microbes to protect his farm.
    1. Name an alternate method to introduce the gene of interest the pathogen would have otherwise delivered and discuss how the alternate method would deliver the gene.
    2. State how this gene would control the pest.
Concept: undefined - undefined
Chapter:
OR
[5]32.B

BamH1 is a restriction enzyme which recognizes the sequence 5'-GGATCC-3'. The restriction activity of this enzyme is between G and G.

  1. Construct the palindrome for the above sequence.
  2. Draw a labeled diagram to show the formation of recombinant DNA (rDNA) using BamH1.
  3. PBR322 is a plasmid that has a restriction site for this enzyme at the tetracycline-resistant gene. If BamH1 were to be used, how will it impact the response of the transformant with rDNA to the antibiotics ampicillin and tetracycline? Justify.
Concept: undefined - undefined
Chapter:
[5]33
[5]33.A
[1]33.A.i

Justify the following statement with suitable proof/examples:

‘Competition is not limited to closely related species.’

Concept: undefined - undefined
Chapter:
[1]33.A.ii

Justify the following statement with suitable proof/examples:

‘Competition is not always dependent on resources being limiting.’

Concept: undefined - undefined
Chapter:
[1]33.A.iii

Justify the following statement with suitable proof/examples:

‘Competitive exclusion occurs in nature.’

Concept: undefined - undefined
Chapter:
[1]33.A.iv

Justify the following statement with suitable proof/examples:

‘Competing species may evolve mechanisms for co-existence.’

Concept: undefined - undefined
Chapter:
[1]33.A.v

Justify the following statement with suitable proof/examples:

‘Competition in nature comes from what is called competitive release.’

Concept: undefined - undefined
Chapter:
OR
[5]33.B
[2]33.B.i

How does a simple food chain exemplify the First Law of Thermodynamics?

Concept: undefined - undefined
Chapter:
[3]33.B.ii

The table below shows the number of species in different parts of the world. 

Name of Place Number of Bird species
Columbia 1400
India 1200
Northern South America 1300
New York 105
Denmark 504

Identify the common factor in regions with a higher number of bird species and suggest at least two reasons for this greater diversity.

Concept: undefined - undefined
Chapter:

Other Solutions





































Submit Question Paper

Help us maintain new question papers on Shaalaa.com, so we can continue to help students




only jpg, png and pdf files

CBSE previous year question papers Class 12 Biology with solutions 2025 - 2026

     CBSE Class 12 question paper solution is key to score more marks in final exams. Students who have used our past year paper solution have significantly improved in speed and boosted their confidence to solve any question in the examination. Our CBSE Class 12 question paper 2026 serve as a catalyst to prepare for your Biology board examination.
     Previous year Question paper for CBSE Class 12 -2026 is solved by experts. Solved question papers gives you the chance to check yourself after your mock test.
     By referring the question paper Solutions for Biology, you can scale your preparation level and work on your weak areas. It will also help the candidates in developing the time-management skills. Practice makes perfect, and there is no better way to practice than to attempt previous year question paper solutions of CBSE Class 12.

How CBSE Class 12 Question Paper solutions Help Students ?
• Question paper solutions for Biology will helps students to prepare for exam.
• Question paper with answer will boost students confidence in exam time and also give you an idea About the important questions and topics to be prepared for the board exam.
• For finding solution of question papers no need to refer so multiple sources like textbook or guides.
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×