Advertisement Remove all ads

CBSE (Science) (Hindi Medium) Class 12 [१२ वीं कक्षा] - CBSE Question Bank Solutions

Subjects
Topics
Subjects
Popular subjects
Topics

Please select a subject first

Advertisement Remove all ads
Advertisement Remove all ads
< prev  21 to 40 of 5890  next > 

पुरुष जनन तन्त्र का एक नामांकित आरेख बनाएँ।

[0.03] मानव जनन
Chapter: [0.03] मानव जनन
Concept: पुरुष जनन तंत्र

वृषण तथा अण्डाशय के बारे में प्रत्येक के दो-दो प्रमुख कार्यों का वर्णन कीजिए।

[0.03] मानव जनन
Chapter: [0.03] मानव जनन
Concept: पुरुष जनन तंत्र

पुरुष की सहायक नलिकाओं एवं ग्रन्थियों के प्रमुख कार्य क्या हैं?

[0.03] मानव जनन
Chapter: [0.03] मानव जनन
Concept: पुरुष जनन तंत्र

जनन स्वास्थ्य के उन पहलुओं को सुझाएँ जिन पर आज के परिदृश्य में विशेष ध्यान देने की जरूरत है।

[0.04] जनन स्वास्थ्य
Chapter: [0.04] जनन स्वास्थ्य
Concept: जनन स्वास्थ्य - समस्याएँ एवं कार्यनीतियाँ

क्या विद्यालयों में यौन शिक्षा आवश्यक है? यदि हाँ, तो क्यों?

[0.04] जनन स्वास्थ्य
Chapter: [0.04] जनन स्वास्थ्य
Concept: जनन स्वास्थ्य - समस्याएँ एवं कार्यनीतियाँ

मेंडल द्वारा प्रयोगों के लिए मटर के पौधे को चुनने से क्या लाभ हुए?

[0.05] विधता के सिद्धांत
Chapter: [0.05] विधता के सिद्धांत
Concept: मेंडल के वंशागति के नियम

यदि डी०एन०ए० के एकरज्जुक के अनुक्रम निम्नवत् लिखे हैं –
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
तो पूरक रज्जुक के अनुक्रम को 5 → 3 दिशा में लिखिए।

[0.06] वंशागति के आणविक आधार
Chapter: [0.06] वंशागति के आणविक आधार
Concept: आनुवंशिक पदार्थ की खोज

यदि अनुलेखन इकाई में कूट लेखन रज्जुक के अनुक्रम को निम्नवत् लिखा गया है –
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
तो दूत-आर०एन०ए० के अनुक्रम को लिखिए।

[0.06] वंशागति के आणविक आधार
Chapter: [0.06] वंशागति के आणविक आधार
Concept: आनुवंशिक पदार्थ की खोज

DNA ढिकुंडली की कौन-सी विशेषता ने वाटसन व क्रिक को DNA प्रतिकृति के सेमी कंजर्वेटिव रूप को कल्पित करने में सहयोग किया? इसकी व्याख्या कीजिए।

[0.06] वंशागति के आणविक आधार
Chapter: [0.06] वंशागति के आणविक आधार
Concept: आनुवंशिक पदार्थ की खोज

टेम्पलेट (डी०एन०ए० या आर०एन०ए०) की रासायनिक प्रकृति व इससे (डी०एन०ए० या आर०एन०ए०) संश्लेषित न्यूक्लीक अम्लों की प्रकृति के आधार पर न्यूक्लीक अम्ल पॉलिमरेज के विभिन्न प्रकार की सूची बनाइए।

[0.06] वंशागति के आणविक आधार
Chapter: [0.06] वंशागति के आणविक आधार
Concept: आनुवंशिक पदार्थ की खोज

DNA आनुवंशिक पदार्थ है, इसे सिद्ध करने हेतु अपने प्रयोग के दौरान हर्णे व चेज ने DNA व प्रोटीन के बीच कैसे अंतर स्थापित किया?

[0.06] वंशागति के आणविक आधार
Chapter: [0.06] वंशागति के आणविक आधार
Concept: आनुवंशिक पदार्थ की खोज

निम्न के बीच अंतर बताइए –

पुनरावृत्ति DNA एवं अनुषंगी DNA

[0.06] वंशागति के आणविक आधार
Chapter: [0.06] वंशागति के आणविक आधार
Concept: आनुवंशिक पदार्थ की खोज

निम्न के कार्य का वर्णन (एक अथवा दो पंक्तियों में) कीजिए –

उन्नायक (प्रोमोटर)

[0.06] वंशागति के आणविक आधार
Chapter: [0.06] वंशागति के आणविक आधार
Concept: आनुवंशिक पदार्थ की खोज

प्राथमिक और द्वितीयक लसिकाओं के अंगों के नाम बताइये।

[0.08] मानव स्वास्थ्य तथा रोग
Chapter: [0.08] मानव स्वास्थ्य तथा रोग
Concept: मानव में सामान्य रोग

मानव कल्याण में पशुपालन की भूमिका की संक्षेप में व्याख्या कीजिए।

[0.09] खाद्य उत्पादन में वृद्धि की कार्यनीति
Chapter: [0.09] खाद्य उत्पादन में वृद्धि की कार्यनीति
Concept: पशुपालन

यदि आपके परिवार के पास एक डेरी फार्म है, तब आप दुग्ध उत्पादन में उसकी गुणवत्ता तथा मात्रा में सुधार लाने के लिए कौन-कौन से उपाय करेंगे?

[0.09] खाद्य उत्पादन में वृद्धि की कार्यनीति
Chapter: [0.09] खाद्य उत्पादन में वृद्धि की कार्यनीति
Concept: पशुपालन

मौन (मधुमक्खी) पालन से आप क्या समझते हैं? हमारे जीवन में इसका क्या महत्त्व है?

[0.09] खाद्य उत्पादन में वृद्धि की कार्यनीति
Chapter: [0.09] खाद्य उत्पादन में वृद्धि की कार्यनीति
Concept: पशुपालन

खाद्य उत्पादन को बढ़ाने में मत्स्यकी की भूमिका की विवेचना कीजिए।

[0.09] खाद्य उत्पादन में वृद्धि की कार्यनीति
Chapter: [0.09] खाद्य उत्पादन में वृद्धि की कार्यनीति
Concept: पशुपालन

जीवाणुओं को नग्न आँखों द्वारा नहीं देखा जा सकता, परन्तु सूक्ष्मदर्शी की सहायता से देखा जा सकता है। यदि आपको अपने घर से अपनी जीव विज्ञान प्रयोगशाला तक एक नमूना ले जाना हो और सूक्ष्मदर्शी की सहायता से इस नमूने से सूक्ष्मजीवों की उपस्थिति को प्रदर्शित करना हो तो किस प्रकार का नमूना आप अपने साथ ले जाएँगे और क्यों?

[0.1] मानव कल्याण में सूक्ष्मजीव
Chapter: [0.1] मानव कल्याण में सूक्ष्मजीव
Concept: घरेलू उत्पादों में सूक्ष्मजीव

उपापचय के दौरान सूक्ष्मजीव गैसों का निष्कासन करते हैं; उदाहरण द्वारा सिद्ध कीजिए।

[0.1] मानव कल्याण में सूक्ष्मजीव
Chapter: [0.1] मानव कल्याण में सूक्ष्मजीव
Concept: घरेलू उत्पादों में सूक्ष्मजीव
< prev  21 to 40 of 5890  next > 
Advertisement Remove all ads
Advertisement Remove all ads
Share
Notifications

View all notifications


      Forgot password?
View in app×