Share
Notifications

View all notifications

If the Sequence of One Strand of Dna is Written as Follows - Biology

Login
Create free account


      Forgot password?
ConceptTranscription Transcription Unit

Question

If the sequence of one strand of DNA is written as follows:

5'-ATGCATGCATGCATGCATGCATGCATGC-3'

Write down the sequence of complementary strand in 5'→3direction

Solution

The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is

5'- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complementary strand in 5' to 3' direction will be

3'- TACGTACGTACGTACGTACGTACGTACG − 5’

Therefore, the sequence of nucleotides on DNA polypeptide in 5' to 3' direction is

5'- GCATGCATGCATGCATGCATGCATGCAT− 3

  Is there an error in this question or solution?

APPEARS IN

 NCERT Solution for Biology Textbook for Class 12 (2018 to Current)
Chapter 6: Molecular Basis of Inheritance
Q: 3 | Page no. 125
Solution If the Sequence of One Strand of Dna is Written as Follows Concept: Transcription - Transcription Unit.
S
View in app×