If the Sequence of One Strand of Dna is Written as Follows - Biology

Advertisements
Advertisements

If the sequence of one strand of DNA is written as follows:

5'-ATGCATGCATGCATGCATGCATGCATGC-3'

Write down the sequence of complementary strand in 5'→3direction

Advertisements

Solution

The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is

5'- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complementary strand in 5' to 3' direction will be

3'- TACGTACGTACGTACGTACGTACGTACG − 5’

Therefore, the sequence of nucleotides on DNA polypeptide in 5' to 3' direction is

5'- GCATGCATGCATGCATGCATGCATGCAT− 3

Concept: Protein synthesis - Transcription - Transcription Unit
  Is there an error in this question or solution?
Chapter 6: Molecular Basis of Inheritance - Exercises [Page 125]

APPEARS IN

NCERT Biology Class 12
Chapter 6 Molecular Basis of Inheritance
Exercises | Q 3 | Page 125
Share
Notifications



      Forgot password?
Use app×